Incidental Mutation 'R7896:Unc5c'
ID609670
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7896 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141771161 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 363 (T363S)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075282
AA Change: T363S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: T363S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106236
AA Change: T363S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: T363S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130636
AA Change: T289S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: T289S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142762
AA Change: T363S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: T363S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,004,958 T894A probably damaging Het
Abcc10 T A 17: 46,324,309 H256L probably benign Het
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Actn2 G A 13: 12,294,317 A290V possibly damaging Het
Actrt2 A T 4: 154,667,195 D161E probably benign Het
Adam19 T A 11: 46,137,543 C668S probably damaging Het
Alg8 T C 7: 97,390,916 L435S probably damaging Het
Amz2 G A 11: 109,436,587 E322K possibly damaging Het
Ankrd12 T A 17: 65,985,685 R918* probably null Het
Atp5f1 A G 3: 105,955,943 I59T probably damaging Het
Bach1 T A 16: 87,719,005 C145S possibly damaging Het
Bcl6b G T 11: 70,227,022 S309* probably null Het
Birc6 G T 17: 74,622,082 R2323L probably damaging Het
Catspere2 A T 1: 178,111,174 M538L probably benign Het
Ccdc154 A T 17: 25,171,826 M647L probably benign Het
Cdc14a T C 3: 116,294,833 T447A probably benign Het
Chst9 C T 18: 15,452,789 R239H probably damaging Het
Cs C T 10: 128,353,135 A171V probably damaging Het
D3Ertd751e T A 3: 41,756,073 F107I probably benign Het
D430041D05Rik T C 2: 104,258,040 D197G probably benign Het
Dcdc2c G A 12: 28,470,620 Q486* probably null Het
Dolk A T 2: 30,285,949 V28E possibly damaging Het
Dpf2 C T 19: 5,904,305 S191N probably benign Het
Eml3 T A 19: 8,933,807 F267I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam189a1 T C 7: 64,776,809 H232R probably damaging Het
Foxo3 T C 10: 42,197,736 S262G possibly damaging Het
Gm1527 T G 3: 28,921,593 probably null Het
Gm49380 G A 9: 44,112,799 L51F probably damaging Het
Gm9195 A T 14: 72,455,738 H1582Q unknown Het
Gm9573 G A 17: 35,620,025 P1090S unknown Het
Grip1 A G 10: 119,978,545 Q327R possibly damaging Het
Gstt1 A G 10: 75,784,142 F207S probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kif16b A G 2: 142,834,075 probably null Het
Kif5a A G 10: 127,242,004 V407A probably benign Het
Lrrc57 C A 2: 120,607,891 D134Y probably damaging Het
Map1a A G 2: 121,305,176 T2158A probably benign Het
Mink1 A G 11: 70,612,282 N1068S possibly damaging Het
Mmp8 A T 9: 7,564,977 I295F probably damaging Het
Mup18 G T 4: 61,672,688 probably null Het
Myo1h G T 5: 114,336,311 probably null Het
Nap1l5 C T 6: 58,906,520 G52S probably damaging Het
Npr3 A G 15: 11,883,362 F327S probably damaging Het
Nrxn2 C A 19: 6,532,053 Q1673K possibly damaging Het
Olfr457 T A 6: 42,472,166 D4V probably benign Het
Olfr53 G T 7: 140,652,901 L307F probably benign Het
Paf1 T C 7: 28,396,647 Y260H probably damaging Het
Pcmtd2 T C 2: 181,854,983 I251T probably damaging Het
Pde9a C T 17: 31,459,967 Q261* probably null Het
Ppip5k1 T C 2: 121,347,330 D332G probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp1r36 A G 12: 76,428,149 probably null Het
Pprc1 T C 19: 46,061,449 L67P unknown Het
Prkdc T G 16: 15,708,903 L1346R probably damaging Het
Prl7c1 A T 13: 27,778,087 M79K possibly damaging Het
Ptprb C T 10: 116,369,457 probably null Het
R3hdm1 T A 1: 128,168,966 probably null Het
Ralgapa1 A G 12: 55,697,878 V1276A probably benign Het
Rapsn T C 2: 91,044,955 L361P probably benign Het
Rbm22 G T 18: 60,569,433 A275S probably benign Het
Rsph3a A G 17: 7,946,108 Y100C probably damaging Het
Rsrp1 A T 4: 134,923,963 M13L unknown Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Setd7 C A 3: 51,536,656 probably null Het
Slc38a2 A G 15: 96,693,585 I206T probably damaging Het
Slc9a8 T C 2: 167,465,358 F321L probably benign Het
Sppl2c A G 11: 104,187,130 D252G possibly damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Syne2 A G 12: 76,035,623 T117A probably damaging Het
Szt2 A T 4: 118,402,913 F79I possibly damaging Het
Tlr3 T A 8: 45,397,053 K860* probably null Het
Ttn T C 2: 76,794,674 S15187G probably benign Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Usp40 G A 1: 87,978,479 T678I possibly damaging Het
Vmn1r62 A T 7: 5,675,610 T97S probably damaging Het
Vmn1r85 T A 7: 13,084,521 H232L probably benign Het
Vmn2r67 A G 7: 85,136,712 I695T probably damaging Het
Zfp383 C A 7: 29,912,201 D35E probably damaging Het
Zfp65 A T 13: 67,729,055 probably null Het
Zfp692 A G 11: 58,314,236 K437R probably damaging Het
Zfp831 A T 2: 174,647,128 T1199S possibly damaging Het
Zfr T A 15: 12,146,377 I338N probably damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7936:Unc5c UTSW 3 141828477 missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
R8669:Unc5c UTSW 3 141803943 missense possibly damaging 0.91
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGAGTACTGCTCCTTCTG -3'
(R):5'- GCTATGATTCATTTCAGTTCCCAAG -3'

Sequencing Primer
(F):5'- GAGTACTGCTCCTTCTGACCTCATG -3'
(R):5'- TTCAGTTCCCAAGATATTAACTCAAC -3'
Posted On2019-12-20