Mutagenetix > Incidental Mutation

Incidental Mutation 'R7896:Szt2'

609671

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R7896 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118402913 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 79 (F79I)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075406
AA Change: F79I

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: F79I

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	G	10: 80,004,958	T894A	probably damaging	Het
Abcc10	T	A	17: 46,324,309	H256L	probably benign	Het
Abcc6	A	G	7: 45,977,379	L1418P	probably damaging	Het
Actn2	G	A	13: 12,294,317	A290V	possibly damaging	Het
Actrt2	A	T	4: 154,667,195	D161E	probably benign	Het
Adam19	T	A	11: 46,137,543	C668S	probably damaging	Het
Alg8	T	C	7: 97,390,916	L435S	probably damaging	Het
Amz2	G	A	11: 109,436,587	E322K	possibly damaging	Het
Ankrd12	T	A	17: 65,985,685	R918*	probably null	Het
Atp5f1	A	G	3: 105,955,943	I59T	probably damaging	Het
Bach1	T	A	16: 87,719,005	C145S	possibly damaging	Het
Bcl6b	G	T	11: 70,227,022	S309*	probably null	Het
Birc6	G	T	17: 74,622,082	R2323L	probably damaging	Het
Catspere2	A	T	1: 178,111,174	M538L	probably benign	Het
Ccdc154	A	T	17: 25,171,826	M647L	probably benign	Het
Cdc14a	T	C	3: 116,294,833	T447A	probably benign	Het
Chst9	C	T	18: 15,452,789	R239H	probably damaging	Het
Cs	C	T	10: 128,353,135	A171V	probably damaging	Het
D3Ertd751e	T	A	3: 41,756,073	F107I	probably benign	Het
D430041D05Rik	T	C	2: 104,258,040	D197G	probably benign	Het
Dcdc2c	G	A	12: 28,470,620	Q486*	probably null	Het
Dolk	A	T	2: 30,285,949	V28E	possibly damaging	Het
Dpf2	C	T	19: 5,904,305	S191N	probably benign	Het
Eml3	T	A	19: 8,933,807	F267I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam189a1	T	C	7: 64,776,809	H232R	probably damaging	Het
Foxo3	T	C	10: 42,197,736	S262G	possibly damaging	Het
Gm1527	T	G	3: 28,921,593		probably null	Het
Gm49380	G	A	9: 44,112,799	L51F	probably damaging	Het
Gm9195	A	T	14: 72,455,738	H1582Q	unknown	Het
Gm9573	G	A	17: 35,620,025	P1090S	unknown	Het
Grip1	A	G	10: 119,978,545	Q327R	possibly damaging	Het
Gstt1	A	G	10: 75,784,142	F207S	probably damaging	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Kif16b	A	G	2: 142,834,075		probably null	Het
Kif5a	A	G	10: 127,242,004	V407A	probably benign	Het
Lrrc57	C	A	2: 120,607,891	D134Y	probably damaging	Het
Map1a	A	G	2: 121,305,176	T2158A	probably benign	Het
Mink1	A	G	11: 70,612,282	N1068S	possibly damaging	Het
Mmp8	A	T	9: 7,564,977	I295F	probably damaging	Het
Mup18	G	T	4: 61,672,688		probably null	Het
Myo1h	G	T	5: 114,336,311		probably null	Het
Nap1l5	C	T	6: 58,906,520	G52S	probably damaging	Het
Npr3	A	G	15: 11,883,362	F327S	probably damaging	Het
Nrxn2	C	A	19: 6,532,053	Q1673K	possibly damaging	Het
Olfr457	T	A	6: 42,472,166	D4V	probably benign	Het
Olfr53	G	T	7: 140,652,901	L307F	probably benign	Het
Paf1	T	C	7: 28,396,647	Y260H	probably damaging	Het
Pcmtd2	T	C	2: 181,854,983	I251T	probably damaging	Het
Pde9a	C	T	17: 31,459,967	Q261*	probably null	Het
Ppip5k1	T	C	2: 121,347,330	D332G	probably damaging	Het
Ppl	C	T	16: 5,088,861	R1190H	probably damaging	Het
Ppp1r36	A	G	12: 76,428,149		probably null	Het
Pprc1	T	C	19: 46,061,449	L67P	unknown	Het
Prkdc	T	G	16: 15,708,903	L1346R	probably damaging	Het
Prl7c1	A	T	13: 27,778,087	M79K	possibly damaging	Het
Ptprb	C	T	10: 116,369,457		probably null	Het
R3hdm1	T	A	1: 128,168,966		probably null	Het
Ralgapa1	A	G	12: 55,697,878	V1276A	probably benign	Het
Rapsn	T	C	2: 91,044,955	L361P	probably benign	Het
Rbm22	G	T	18: 60,569,433	A275S	probably benign	Het
Rsph3a	A	G	17: 7,946,108	Y100C	probably damaging	Het
Rsrp1	A	T	4: 134,923,963	M13L	unknown	Het
Rtn4	T	G	11: 29,705,536	D169E	probably damaging	Het
Setd7	C	A	3: 51,536,656		probably null	Het
Slc38a2	A	G	15: 96,693,585	I206T	probably damaging	Het
Slc9a8	T	C	2: 167,465,358	F321L	probably benign	Het
Sppl2c	A	G	11: 104,187,130	D252G	possibly damaging	Het
Srgap1	CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC	CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC	10: 121,853,553		probably benign	Het
Syne2	A	G	12: 76,035,623	T117A	probably damaging	Het
Tlr3	T	A	8: 45,397,053	K860*	probably null	Het
Ttn	T	C	2: 76,794,674	S15187G	probably benign	Het
Ubr5	A	G	15: 38,041,573	V204A	probably benign	Het
Unc5c	A	T	3: 141,771,161	T363S	possibly damaging	Het
Usp40	G	A	1: 87,978,479	T678I	possibly damaging	Het
Vmn1r62	A	T	7: 5,675,610	T97S	probably damaging	Het
Vmn1r85	T	A	7: 13,084,521	H232L	probably benign	Het
Vmn2r67	A	G	7: 85,136,712	I695T	probably damaging	Het
Zfp383	C	A	7: 29,912,201	D35E	probably damaging	Het
Zfp65	A	T	13: 67,729,055		probably null	Het
Zfp692	A	G	11: 58,314,236	K437R	probably damaging	Het
Zfp831	A	T	2: 174,647,128	T1199S	possibly damaging	Het
Zfr	T	A	15: 12,146,377	I338N	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCCATTTCCAGGTGTGTC -3'
(R):5'- CCTGTGAGTCCAGGTTAGTCAG -3'

Sequencing Primer
(F):5'- AGGTGTGTCTTTTCCCCACAGG -3'
(R):5'- CAGTTCTGAGGATTTTCTGAGAGCAC -3'

Posted On

2019-12-20