Incidental Mutation 'R7896:Szt2'
ID 609671
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 045948-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R7896 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 118260110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 79 (F79I)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000075406
AA Change: F79I

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: F79I

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 79,840,792 (GRCm39) T894A probably damaging Het
Abcc10 T A 17: 46,635,235 (GRCm39) H256L probably benign Het
Abcc6 A G 7: 45,626,803 (GRCm39) L1418P probably damaging Het
Actn2 G A 13: 12,309,203 (GRCm39) A290V possibly damaging Het
Actrt2 A T 4: 154,751,652 (GRCm39) D161E probably benign Het
Adam19 T A 11: 46,028,370 (GRCm39) C668S probably damaging Het
Alg8 T C 7: 97,040,123 (GRCm39) L435S probably damaging Het
Amz2 G A 11: 109,327,413 (GRCm39) E322K possibly damaging Het
Ankrd12 T A 17: 66,292,680 (GRCm39) R918* probably null Het
Atp5pb A G 3: 105,863,259 (GRCm39) I59T probably damaging Het
Bach1 T A 16: 87,515,893 (GRCm39) C145S possibly damaging Het
Bcl6b G T 11: 70,117,848 (GRCm39) S309* probably null Het
Birc6 G T 17: 74,929,077 (GRCm39) R2323L probably damaging Het
Catspere2 A T 1: 177,938,740 (GRCm39) M538L probably benign Het
Ccdc154 A T 17: 25,390,800 (GRCm39) M647L probably benign Het
Cdc14a T C 3: 116,088,482 (GRCm39) T447A probably benign Het
Chst9 C T 18: 15,585,846 (GRCm39) R239H probably damaging Het
Cs C T 10: 128,189,004 (GRCm39) A171V probably damaging Het
D3Ertd751e T A 3: 41,710,508 (GRCm39) F107I probably benign Het
D430041D05Rik T C 2: 104,088,385 (GRCm39) D197G probably benign Het
Dcdc2c G A 12: 28,520,619 (GRCm39) Q486* probably null Het
Dolk A T 2: 30,175,961 (GRCm39) V28E possibly damaging Het
Dpf2 C T 19: 5,954,333 (GRCm39) S191N probably benign Het
Eml3 T A 19: 8,911,171 (GRCm39) F267I possibly damaging Het
Entrep2 T C 7: 64,426,557 (GRCm39) H232R probably damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Foxo3 T C 10: 42,073,732 (GRCm39) S262G possibly damaging Het
Gm1527 T G 3: 28,975,742 (GRCm39) probably null Het
Gm49380 G A 9: 44,024,096 (GRCm39) L51F probably damaging Het
Gm9195 A T 14: 72,693,178 (GRCm39) H1582Q unknown Het
Grip1 A G 10: 119,814,450 (GRCm39) Q327R possibly damaging Het
Gstt1 A G 10: 75,619,976 (GRCm39) F207S probably damaging Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Kif16b A G 2: 142,675,995 (GRCm39) probably null Het
Kif5a A G 10: 127,077,873 (GRCm39) V407A probably benign Het
Lrrc57 C A 2: 120,438,372 (GRCm39) D134Y probably damaging Het
Map1a A G 2: 121,135,657 (GRCm39) T2158A probably benign Het
Mink1 A G 11: 70,503,108 (GRCm39) N1068S possibly damaging Het
Mmp8 A T 9: 7,564,978 (GRCm39) I295F probably damaging Het
Muc21 G A 17: 35,930,917 (GRCm39) P1090S unknown Het
Mup18 G T 4: 61,590,925 (GRCm39) probably null Het
Myo1h G T 5: 114,474,372 (GRCm39) probably null Het
Nap1l5 C T 6: 58,883,505 (GRCm39) G52S probably damaging Het
Npr3 A G 15: 11,883,448 (GRCm39) F327S probably damaging Het
Nrxn2 C A 19: 6,582,083 (GRCm39) Q1673K possibly damaging Het
Or13a20 G T 7: 140,232,814 (GRCm39) L307F probably benign Het
Or2r3 T A 6: 42,449,100 (GRCm39) D4V probably benign Het
Paf1 T C 7: 28,096,072 (GRCm39) Y260H probably damaging Het
Pcmtd2 T C 2: 181,496,776 (GRCm39) I251T probably damaging Het
Pde9a C T 17: 31,678,941 (GRCm39) Q261* probably null Het
Ppip5k1 T C 2: 121,177,811 (GRCm39) D332G probably damaging Het
Ppl C T 16: 4,906,725 (GRCm39) R1190H probably damaging Het
Ppp1r36 A G 12: 76,474,923 (GRCm39) probably null Het
Pprc1 T C 19: 46,049,888 (GRCm39) L67P unknown Het
Prkdc T G 16: 15,526,767 (GRCm39) L1346R probably damaging Het
Prl7c1 A T 13: 27,962,070 (GRCm39) M79K possibly damaging Het
Ptprb C T 10: 116,205,362 (GRCm39) probably null Het
R3hdm1 T A 1: 128,096,703 (GRCm39) probably null Het
Ralgapa1 A G 12: 55,744,663 (GRCm39) V1276A probably benign Het
Rapsn T C 2: 90,875,300 (GRCm39) L361P probably benign Het
Rbm22 G T 18: 60,702,505 (GRCm39) A275S probably benign Het
Rsph3a A G 17: 8,164,940 (GRCm39) Y100C probably damaging Het
Rsrp1 A T 4: 134,651,274 (GRCm39) M13L unknown Het
Rtn4 T G 11: 29,655,536 (GRCm39) D169E probably damaging Het
Setd7 C A 3: 51,444,077 (GRCm39) probably null Het
Slc38a2 A G 15: 96,591,466 (GRCm39) I206T probably damaging Het
Slc9a8 T C 2: 167,307,278 (GRCm39) F321L probably benign Het
Sppl2c A G 11: 104,077,956 (GRCm39) D252G possibly damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,689,458 (GRCm39) probably benign Het
Syne2 A G 12: 76,082,397 (GRCm39) T117A probably damaging Het
Tlr3 T A 8: 45,850,090 (GRCm39) K860* probably null Het
Ttn T C 2: 76,625,018 (GRCm39) S15187G probably benign Het
Ubr5 A G 15: 38,041,817 (GRCm39) V204A probably benign Het
Unc5c A T 3: 141,476,922 (GRCm39) T363S possibly damaging Het
Usp40 G A 1: 87,906,201 (GRCm39) T678I possibly damaging Het
Vmn1r62 A T 7: 5,678,609 (GRCm39) T97S probably damaging Het
Vmn1r85 T A 7: 12,818,448 (GRCm39) H232L probably benign Het
Vmn2r67 A G 7: 84,785,920 (GRCm39) I695T probably damaging Het
Zfp383 C A 7: 29,611,626 (GRCm39) D35E probably damaging Het
Zfp65 A T 13: 67,877,174 (GRCm39) probably null Het
Zfp692 A G 11: 58,205,062 (GRCm39) K437R probably damaging Het
Zfp831 A T 2: 174,488,921 (GRCm39) T1199S possibly damaging Het
Zfr T A 15: 12,146,463 (GRCm39) I338N probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCATTTCCAGGTGTGTC -3'
(R):5'- CCTGTGAGTCCAGGTTAGTCAG -3'

Sequencing Primer
(F):5'- AGGTGTGTCTTTTCCCCACAGG -3'
(R):5'- CAGTTCTGAGGATTTTCTGAGAGCAC -3'
Posted On 2019-12-20