Incidental Mutation 'R7896:Rsrp1'
ID 609672
Institutional Source Beutler Lab
Gene Symbol Rsrp1
Ensembl Gene ENSMUSG00000037266
Gene Name arginine/serine rich protein 1
Synonyms D4Ucla2, D4Wsu53e, 2700043I21Rik
MMRRC Submission 045948-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7896 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 134650936-134654681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 134651274 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 13 (M13L)
Ref Sequence ENSEMBL: ENSMUSP00000077226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078084]
AlphaFold Q3UC65
Predicted Effect unknown
Transcript: ENSMUST00000078084
AA Change: M13L
SMART Domains Protein: ENSMUSP00000077226
Gene: ENSMUSG00000037266
AA Change: M13L

DomainStartEndE-ValueType
Pfam:RSRP 6 298 5.9e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 79,840,792 (GRCm39) T894A probably damaging Het
Abcc10 T A 17: 46,635,235 (GRCm39) H256L probably benign Het
Abcc6 A G 7: 45,626,803 (GRCm39) L1418P probably damaging Het
Actn2 G A 13: 12,309,203 (GRCm39) A290V possibly damaging Het
Actrt2 A T 4: 154,751,652 (GRCm39) D161E probably benign Het
Adam19 T A 11: 46,028,370 (GRCm39) C668S probably damaging Het
Alg8 T C 7: 97,040,123 (GRCm39) L435S probably damaging Het
Amz2 G A 11: 109,327,413 (GRCm39) E322K possibly damaging Het
Ankrd12 T A 17: 66,292,680 (GRCm39) R918* probably null Het
Atp5pb A G 3: 105,863,259 (GRCm39) I59T probably damaging Het
Bach1 T A 16: 87,515,893 (GRCm39) C145S possibly damaging Het
Bcl6b G T 11: 70,117,848 (GRCm39) S309* probably null Het
Birc6 G T 17: 74,929,077 (GRCm39) R2323L probably damaging Het
Catspere2 A T 1: 177,938,740 (GRCm39) M538L probably benign Het
Ccdc154 A T 17: 25,390,800 (GRCm39) M647L probably benign Het
Cdc14a T C 3: 116,088,482 (GRCm39) T447A probably benign Het
Chst9 C T 18: 15,585,846 (GRCm39) R239H probably damaging Het
Cs C T 10: 128,189,004 (GRCm39) A171V probably damaging Het
D3Ertd751e T A 3: 41,710,508 (GRCm39) F107I probably benign Het
D430041D05Rik T C 2: 104,088,385 (GRCm39) D197G probably benign Het
Dcdc2c G A 12: 28,520,619 (GRCm39) Q486* probably null Het
Dolk A T 2: 30,175,961 (GRCm39) V28E possibly damaging Het
Dpf2 C T 19: 5,954,333 (GRCm39) S191N probably benign Het
Eml3 T A 19: 8,911,171 (GRCm39) F267I possibly damaging Het
Entrep2 T C 7: 64,426,557 (GRCm39) H232R probably damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Foxo3 T C 10: 42,073,732 (GRCm39) S262G possibly damaging Het
Gm1527 T G 3: 28,975,742 (GRCm39) probably null Het
Gm49380 G A 9: 44,024,096 (GRCm39) L51F probably damaging Het
Gm9195 A T 14: 72,693,178 (GRCm39) H1582Q unknown Het
Grip1 A G 10: 119,814,450 (GRCm39) Q327R possibly damaging Het
Gstt1 A G 10: 75,619,976 (GRCm39) F207S probably damaging Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Kif16b A G 2: 142,675,995 (GRCm39) probably null Het
Kif5a A G 10: 127,077,873 (GRCm39) V407A probably benign Het
Lrrc57 C A 2: 120,438,372 (GRCm39) D134Y probably damaging Het
Map1a A G 2: 121,135,657 (GRCm39) T2158A probably benign Het
Mink1 A G 11: 70,503,108 (GRCm39) N1068S possibly damaging Het
Mmp8 A T 9: 7,564,978 (GRCm39) I295F probably damaging Het
Muc21 G A 17: 35,930,917 (GRCm39) P1090S unknown Het
Mup18 G T 4: 61,590,925 (GRCm39) probably null Het
Myo1h G T 5: 114,474,372 (GRCm39) probably null Het
Nap1l5 C T 6: 58,883,505 (GRCm39) G52S probably damaging Het
Npr3 A G 15: 11,883,448 (GRCm39) F327S probably damaging Het
Nrxn2 C A 19: 6,582,083 (GRCm39) Q1673K possibly damaging Het
Or13a20 G T 7: 140,232,814 (GRCm39) L307F probably benign Het
Or2r3 T A 6: 42,449,100 (GRCm39) D4V probably benign Het
Paf1 T C 7: 28,096,072 (GRCm39) Y260H probably damaging Het
Pcmtd2 T C 2: 181,496,776 (GRCm39) I251T probably damaging Het
Pde9a C T 17: 31,678,941 (GRCm39) Q261* probably null Het
Ppip5k1 T C 2: 121,177,811 (GRCm39) D332G probably damaging Het
Ppl C T 16: 4,906,725 (GRCm39) R1190H probably damaging Het
Ppp1r36 A G 12: 76,474,923 (GRCm39) probably null Het
Pprc1 T C 19: 46,049,888 (GRCm39) L67P unknown Het
Prkdc T G 16: 15,526,767 (GRCm39) L1346R probably damaging Het
Prl7c1 A T 13: 27,962,070 (GRCm39) M79K possibly damaging Het
Ptprb C T 10: 116,205,362 (GRCm39) probably null Het
R3hdm1 T A 1: 128,096,703 (GRCm39) probably null Het
Ralgapa1 A G 12: 55,744,663 (GRCm39) V1276A probably benign Het
Rapsn T C 2: 90,875,300 (GRCm39) L361P probably benign Het
Rbm22 G T 18: 60,702,505 (GRCm39) A275S probably benign Het
Rsph3a A G 17: 8,164,940 (GRCm39) Y100C probably damaging Het
Rtn4 T G 11: 29,655,536 (GRCm39) D169E probably damaging Het
Setd7 C A 3: 51,444,077 (GRCm39) probably null Het
Slc38a2 A G 15: 96,591,466 (GRCm39) I206T probably damaging Het
Slc9a8 T C 2: 167,307,278 (GRCm39) F321L probably benign Het
Sppl2c A G 11: 104,077,956 (GRCm39) D252G possibly damaging Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,689,458 (GRCm39) probably benign Het
Syne2 A G 12: 76,082,397 (GRCm39) T117A probably damaging Het
Szt2 A T 4: 118,260,110 (GRCm39) F79I possibly damaging Het
Tlr3 T A 8: 45,850,090 (GRCm39) K860* probably null Het
Ttn T C 2: 76,625,018 (GRCm39) S15187G probably benign Het
Ubr5 A G 15: 38,041,817 (GRCm39) V204A probably benign Het
Unc5c A T 3: 141,476,922 (GRCm39) T363S possibly damaging Het
Usp40 G A 1: 87,906,201 (GRCm39) T678I possibly damaging Het
Vmn1r62 A T 7: 5,678,609 (GRCm39) T97S probably damaging Het
Vmn1r85 T A 7: 12,818,448 (GRCm39) H232L probably benign Het
Vmn2r67 A G 7: 84,785,920 (GRCm39) I695T probably damaging Het
Zfp383 C A 7: 29,611,626 (GRCm39) D35E probably damaging Het
Zfp65 A T 13: 67,877,174 (GRCm39) probably null Het
Zfp692 A G 11: 58,205,062 (GRCm39) K437R probably damaging Het
Zfp831 A T 2: 174,488,921 (GRCm39) T1199S possibly damaging Het
Zfr T A 15: 12,146,463 (GRCm39) I338N probably damaging Het
Other mutations in Rsrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Rsrp1 APN 4 134,651,290 (GRCm39) missense unknown
IGL03065:Rsrp1 APN 4 134,651,700 (GRCm39) missense possibly damaging 0.95
R0735:Rsrp1 UTSW 4 134,651,568 (GRCm39) missense unknown
R1863:Rsrp1 UTSW 4 134,651,388 (GRCm39) missense unknown
R4670:Rsrp1 UTSW 4 134,651,488 (GRCm39) missense unknown
R5705:Rsrp1 UTSW 4 134,651,331 (GRCm39) missense unknown
R6020:Rsrp1 UTSW 4 134,651,692 (GRCm39) missense probably damaging 0.97
R6195:Rsrp1 UTSW 4 134,654,113 (GRCm39) missense probably damaging 1.00
R6233:Rsrp1 UTSW 4 134,654,113 (GRCm39) missense probably damaging 1.00
R8143:Rsrp1 UTSW 4 134,654,319 (GRCm39) missense probably benign 0.13
R8695:Rsrp1 UTSW 4 134,652,610 (GRCm39) missense probably damaging 0.99
RF013:Rsrp1 UTSW 4 134,651,266 (GRCm39) missense unknown
X0021:Rsrp1 UTSW 4 134,654,070 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTCTTCATCCGTTTAAGGTGAGTGG -3'
(R):5'- GTGAGTAGCGCCTGTACTTG -3'

Sequencing Primer
(F):5'- TAAGGTGAGTGGGGCCGC -3'
(R):5'- CGCCTGTACTTGCGCTG -3'
Posted On 2019-12-20