Incidental Mutation 'R0681:Htra1'
ID60968
Institutional Source Beutler Lab
Gene Symbol Htra1
Ensembl Gene ENSMUSG00000006205
Gene NameHtrA serine peptidase 1
SynonymsPrss11, insulin-like growth factor binding protein 5 protease, RSPP11, L56, HtrA1
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0681 (G1)
Quality Score83
Status Validated
Chromosome7
Chromosomal Location130936111-130985660 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 130979297 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006367] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000006367
SMART Domains Protein: ENSMUSP00000006367
Gene: ENSMUSG00000006205

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 35 112 2.49e-24 SMART
KAZAL 109 155 4.28e-13 SMART
Pfam:Trypsin 192 364 3.5e-17 PFAM
Pfam:Trypsin_2 204 342 3.1e-35 PFAM
PDZ 381 466 7.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153290
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This protein is a secreted enzyme that is proposed to regulate the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins. It has also been suggested to be a regulator of cell growth. Variations in the promoter region of this gene are the cause of susceptibility to age-related macular degeneration type 7. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal retinal morphology. Mice homozygous for a different allele exhibit increased bone volume and increased trabecular bone thickness without body weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Htra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Htra1 APN 7 130936378 missense probably benign
IGL02500:Htra1 APN 7 130984974 missense probably benign 0.01
IGL02708:Htra1 APN 7 130962035 missense probably damaging 1.00
IGL03341:Htra1 APN 7 130981714 missense probably benign 0.04
R0045:Htra1 UTSW 7 130961532 missense probably damaging 1.00
R0045:Htra1 UTSW 7 130961532 missense probably damaging 1.00
R0387:Htra1 UTSW 7 130979478 missense probably damaging 1.00
R0963:Htra1 UTSW 7 130982279 missense possibly damaging 0.75
R1244:Htra1 UTSW 7 130985069 missense possibly damaging 0.87
R1892:Htra1 UTSW 7 130985069 missense possibly damaging 0.87
R2279:Htra1 UTSW 7 130962022 missense probably damaging 1.00
R4084:Htra1 UTSW 7 130936344 missense probably benign 0.00
R4774:Htra1 UTSW 7 130985026 missense probably benign 0.29
R4880:Htra1 UTSW 7 130962083 missense probably damaging 1.00
R4909:Htra1 UTSW 7 130985072 missense probably benign 0.43
R5183:Htra1 UTSW 7 130983716 missense possibly damaging 0.58
R5819:Htra1 UTSW 7 130981739 missense probably damaging 1.00
R5893:Htra1 UTSW 7 130961591 missense probably damaging 1.00
R6709:Htra1 UTSW 7 130936218 intron probably benign
R6845:Htra1 UTSW 7 130936291 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGATTCCTCCAAGGCACATGGGC -3'
(R):5'- TGAGACTGGCTACCCACTCACTTC -3'

Sequencing Primer
(F):5'- TCTGTCCAGATGCACAGATG -3'
(R):5'- GTTCTGGGAAATCATGCAGACTAC -3'
Posted On2013-07-30