Incidental Mutation 'R0681:Mtus1'
ID60969
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R0681 (G1)
Quality Score163
Status Validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40993517 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 489 (L489Q)
Ref Sequence ENSEMBL: ENSMUSP00000091252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034004] [ENSMUST00000051379] [ENSMUST00000059115] [ENSMUST00000093534] [ENSMUST00000118835]
Predicted Effect probably benign
Transcript: ENSMUST00000034004
SMART Domains Protein: ENSMUSP00000034004
Gene: ENSMUSG00000031595

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
IG_like 81 168 5.41e0 SMART
SCOP:d1fltx_ 171 260 4e-23 SMART
IG 278 375 2.75e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000051379
AA Change: L409Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053554
Gene: ENSMUSG00000045636
AA Change: L409Q

DomainStartEndE-ValueType
coiled coil region 106 168 N/A INTRINSIC
coiled coil region 193 375 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059115
AA Change: L1179Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636
AA Change: L1179Q

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093534
AA Change: L489Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091252
Gene: ENSMUSG00000045636
AA Change: L489Q

DomainStartEndE-ValueType
coiled coil region 186 248 N/A INTRINSIC
coiled coil region 273 455 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118835
AA Change: L1179Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636
AA Change: L1179Q

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Meta Mutation Damage Score 0.1233 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0357:Mtus1 UTSW 8 41083526 missense possibly damaging 0.71
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2063:Mtus1 UTSW 8 41082708 missense probably damaging 1.00
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4940:Mtus1 UTSW 8 41041478 missense possibly damaging 0.52
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5860:Mtus1 UTSW 8 41076266 missense probably damaging 0.99
R5900:Mtus1 UTSW 8 41083497 missense possibly damaging 0.92
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7308:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R7424:Mtus1 UTSW 8 41022406 missense probably damaging 1.00
R7481:Mtus1 UTSW 8 41084615 missense probably damaging 0.99
R7485:Mtus1 UTSW 8 41084553 missense probably benign 0.37
R7660:Mtus1 UTSW 8 41016211 missense probably benign
R7699:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7700:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7709:Mtus1 UTSW 8 41054650 missense possibly damaging 0.81
R7791:Mtus1 UTSW 8 41083380 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGAGAGCTAACGCAGCAACTCG -3'
(R):5'- CTGGACAAGAACCTGTGTATTCCCC -3'

Sequencing Primer
(F):5'- AGTTCCCATGAACTCTGAACTTCG -3'
(R):5'- TGTGTATTCCCCCAGAAGAAG -3'
Posted On2013-07-30