Incidental Mutation 'R7896:Srgap1'
ID609693
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R7896 (G1)
Quality Score214.458
Status Validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC to CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC at 121853553 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
PDB Structure Crystal structure of srGAP1 SH3 domain in the slit-robo signaling pathway [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020322
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081688
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,004,958 T894A probably damaging Het
Abcc10 T A 17: 46,324,309 H256L probably benign Het
Abcc6 A G 7: 45,977,379 L1418P probably damaging Het
Actn2 G A 13: 12,294,317 A290V possibly damaging Het
Actrt2 A T 4: 154,667,195 D161E probably benign Het
Adam19 T A 11: 46,137,543 C668S probably damaging Het
Alg8 T C 7: 97,390,916 L435S probably damaging Het
Amz2 G A 11: 109,436,587 E322K possibly damaging Het
Ankrd12 T A 17: 65,985,685 R918* probably null Het
Atp5f1 A G 3: 105,955,943 I59T probably damaging Het
Bach1 T A 16: 87,719,005 C145S possibly damaging Het
Bcl6b G T 11: 70,227,022 S309* probably null Het
Birc6 G T 17: 74,622,082 R2323L probably damaging Het
Catspere2 A T 1: 178,111,174 M538L probably benign Het
Ccdc154 A T 17: 25,171,826 M647L probably benign Het
Cdc14a T C 3: 116,294,833 T447A probably benign Het
Chst9 C T 18: 15,452,789 R239H probably damaging Het
Cs C T 10: 128,353,135 A171V probably damaging Het
D3Ertd751e T A 3: 41,756,073 F107I probably benign Het
D430041D05Rik T C 2: 104,258,040 D197G probably benign Het
Dcdc2c G A 12: 28,470,620 Q486* probably null Het
Dolk A T 2: 30,285,949 V28E possibly damaging Het
Dpf2 C T 19: 5,904,305 S191N probably benign Het
Eml3 T A 19: 8,933,807 F267I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam189a1 T C 7: 64,776,809 H232R probably damaging Het
Foxo3 T C 10: 42,197,736 S262G possibly damaging Het
Gm1527 T G 3: 28,921,593 probably null Het
Gm49380 G A 9: 44,112,799 L51F probably damaging Het
Gm9195 A T 14: 72,455,738 H1582Q unknown Het
Gm9573 G A 17: 35,620,025 P1090S unknown Het
Grip1 A G 10: 119,978,545 Q327R possibly damaging Het
Gstt1 A G 10: 75,784,142 F207S probably damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kif16b A G 2: 142,834,075 probably null Het
Kif5a A G 10: 127,242,004 V407A probably benign Het
Lrrc57 C A 2: 120,607,891 D134Y probably damaging Het
Map1a A G 2: 121,305,176 T2158A probably benign Het
Mink1 A G 11: 70,612,282 N1068S possibly damaging Het
Mmp8 A T 9: 7,564,977 I295F probably damaging Het
Mup18 G T 4: 61,672,688 probably null Het
Myo1h G T 5: 114,336,311 probably null Het
Nap1l5 C T 6: 58,906,520 G52S probably damaging Het
Npr3 A G 15: 11,883,362 F327S probably damaging Het
Nrxn2 C A 19: 6,532,053 Q1673K possibly damaging Het
Olfr457 T A 6: 42,472,166 D4V probably benign Het
Olfr53 G T 7: 140,652,901 L307F probably benign Het
Paf1 T C 7: 28,396,647 Y260H probably damaging Het
Pcmtd2 T C 2: 181,854,983 I251T probably damaging Het
Pde9a C T 17: 31,459,967 Q261* probably null Het
Ppip5k1 T C 2: 121,347,330 D332G probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp1r36 A G 12: 76,428,149 probably null Het
Pprc1 T C 19: 46,061,449 L67P unknown Het
Prkdc T G 16: 15,708,903 L1346R probably damaging Het
Prl7c1 A T 13: 27,778,087 M79K possibly damaging Het
Ptprb C T 10: 116,369,457 probably null Het
R3hdm1 T A 1: 128,168,966 probably null Het
Ralgapa1 A G 12: 55,697,878 V1276A probably benign Het
Rapsn T C 2: 91,044,955 L361P probably benign Het
Rbm22 G T 18: 60,569,433 A275S probably benign Het
Rsph3a A G 17: 7,946,108 Y100C probably damaging Het
Rsrp1 A T 4: 134,923,963 M13L unknown Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Setd7 C A 3: 51,536,656 probably null Het
Slc38a2 A G 15: 96,693,585 I206T probably damaging Het
Slc9a8 T C 2: 167,465,358 F321L probably benign Het
Sppl2c A G 11: 104,187,130 D252G possibly damaging Het
Syne2 A G 12: 76,035,623 T117A probably damaging Het
Szt2 A T 4: 118,402,913 F79I possibly damaging Het
Tlr3 T A 8: 45,397,053 K860* probably null Het
Ttn T C 2: 76,794,674 S15187G probably benign Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Unc5c A T 3: 141,771,161 T363S possibly damaging Het
Usp40 G A 1: 87,978,479 T678I possibly damaging Het
Vmn1r62 A T 7: 5,675,610 T97S probably damaging Het
Vmn1r85 T A 7: 13,084,521 H232L probably benign Het
Vmn2r67 A G 7: 85,136,712 I695T probably damaging Het
Zfp383 C A 7: 29,912,201 D35E probably damaging Het
Zfp65 A T 13: 67,729,055 probably null Het
Zfp692 A G 11: 58,314,236 K437R probably damaging Het
Zfp831 A T 2: 174,647,128 T1199S possibly damaging Het
Zfr T A 15: 12,146,377 I338N probably damaging Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 splice site probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 splice site probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6807:Srgap1 UTSW 10 121828726 splice site probably null
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
R7057:Srgap1 UTSW 10 121804953 missense probably benign 0.20
R7196:Srgap1 UTSW 10 121840848 missense probably benign 0.00
R7247:Srgap1 UTSW 10 121869790 missense probably damaging 0.98
R7404:Srgap1 UTSW 10 121785745 missense probably benign 0.18
R7467:Srgap1 UTSW 10 121855439 nonsense probably null
R7792:Srgap1 UTSW 10 121925967 missense probably damaging 0.98
R7846:Srgap1 UTSW 10 121785492 missense probably damaging 0.97
R7912:Srgap1 UTSW 10 121853553 critical splice donor site probably benign
R8127:Srgap1 UTSW 10 121855366 missense probably null 0.04
R8233:Srgap1 UTSW 10 121825436 missense probably damaging 1.00
R8248:Srgap1 UTSW 10 121804817 missense probably damaging 0.99
R8362:Srgap1 UTSW 10 121855478 missense possibly damaging 0.46
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCAATTTAGGTGTGAGTCCAG -3'
(R):5'- TGCACTGTCAGGTGTGTCAG -3'

Sequencing Primer
(F):5'- GAGTCCAGATCTTTGTGAGCACAC -3'
(R):5'- CACTGTCAGGTGTGTCAGGTCAG -3'
Posted On2019-12-20