Mutagenetix > Incidental Mutation

Incidental Mutation 'R7897:Zfp106'

609735

Institutional Source

Beutler Lab

Gene Symbol

Zfp106

Ensembl Gene

ENSMUSG00000027288

Gene Name

zinc finger protein 106

Synonyms

Cd-1, H3a, Sh3bp3, sirm

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7897 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120506820-120563843 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 120535615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 59 (R59*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000055241
AA Change: R127*

SMART Domains

Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: R127*

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
ZnF_C2H2	43	67	7.18e1	SMART
low complexity region	75	92	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	199	212	N/A	INTRINSIC
low complexity region	466	480	N/A	INTRINSIC
coiled coil region	800	823	N/A	INTRINSIC
low complexity region	842	856	N/A	INTRINSIC
low complexity region	1049	1062	N/A	INTRINSIC
low complexity region	1312	1321	N/A	INTRINSIC
low complexity region	1361	1373	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
WD40	1525	1562	9.24e-4	SMART
WD40	1565	1607	1.83e-7	SMART
PQQ	1587	1618	3.42e2	SMART
WD40	1651	1691	3.45e-1	SMART
PQQ	1671	1702	9.14e1	SMART
WD40	1694	1731	2.12e-3	SMART
PQQ	1711	1742	6.42e0	SMART
WD40	1734	1771	6e-3	SMART
PQQ	1751	1782	5.7e2	SMART
WD40	1774	1811	3.58e-1	SMART
ZnF_C2H2	1818	1843	5.34e-1	SMART
ZnF_C2H2	1851	1879	1.31e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135625

SMART Domains

Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
low complexity region	53	67	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163384

Predicted Effect

probably null
Transcript: ENSMUST00000167241
AA Change: R59*

SMART Domains

Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288
AA Change: R59*

Domain	Start	End	E-Value	Type
ZnF_C2H2	4	28	1.51e0	SMART
low complexity region	74	85	N/A	INTRINSIC
low complexity region	132	145	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171215
AA Change: R104*

SMART Domains

Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: R104*

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	7.18e1	SMART
low complexity region	52	69	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	176	189	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
coiled coil region	777	800	N/A	INTRINSIC
low complexity region	819	833	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1289	1298	N/A	INTRINSIC
low complexity region	1338	1350	N/A	INTRINSIC
low complexity region	1366	1386	N/A	INTRINSIC
WD40	1502	1539	9.24e-4	SMART
WD40	1542	1584	1.83e-7	SMART
PQQ	1564	1595	3.42e2	SMART
WD40	1628	1668	3.45e-1	SMART
PQQ	1648	1679	9.14e1	SMART
WD40	1671	1708	2.12e-3	SMART
PQQ	1688	1719	6.42e0	SMART
WD40	1711	1748	6e-3	SMART
PQQ	1728	1759	5.7e2	SMART
WD40	1751	1788	3.58e-1	SMART
ZnF_C2H2	1795	1820	5.34e-1	SMART
ZnF_C2H2	1828	1856	1.31e2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	A	C	9: 105,144,510	Y112*	probably null	Het
Abcb11	TGTTGATCCATA	T	2: 69,323,872		probably null	Het
Abcb11	GTTGATCCATACA	G	2: 69,323,873		probably benign	Het
Abcc10	T	C	17: 46,324,073	T335A	probably benign	Het
Actr3b	T	C	5: 25,831,659	Y245H	probably benign	Het
Afm	G	A	5: 90,547,868	M411I	probably benign	Het
Ahr	T	C	12: 35,504,170	N650S	possibly damaging	Het
Ap5m1	A	G	14: 49,073,775	R101G	probably benign	Het
Armcx5	AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA	AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA	X: 135,745,704		probably benign	Het
Atp13a4	T	C	16: 29,396,466	Q1151R		Het
Bcl9	A	G	3: 97,205,251	V1296A	possibly damaging	Het
Bsn	A	C	9: 108,111,866	M2229R	probably damaging	Het
Cfap74	T	C	4: 155,429,894	V529A		Het
Clip1	C	T	5: 123,622,798	V767M	probably benign	Het
Col6a5	A	G	9: 105,889,183	I1846T	possibly damaging	Het
Crisp1	A	T	17: 40,307,765	D68E	probably benign	Het
Csmd1	A	T	8: 17,534,919	L19Q	possibly damaging	Het
Cul7	T	C	17: 46,658,005	I892T	probably benign	Het
Elavl3	G	A	9: 22,018,550	R353C	probably damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fbxo3	A	G	2: 104,053,412	D327G	possibly damaging	Het
Galr1	T	C	18: 82,406,131	N7S	probably benign	Het
Glyatl3	T	C	17: 40,904,911	T235A	probably damaging	Het
Gm11639	A	T	11: 104,998,235	Y4159F	probably benign	Het
Gm5145	A	C	17: 20,570,705	Q115P	probably benign	Het
Grm5	T	C	7: 88,130,861	S1202P	probably benign	Het
Itsn1	G	A	16: 91,818,558	R397H	unknown	Het
Jmjd1c	A	G	10: 67,239,865	N1837S	probably damaging	Het
Jph3	A	T	8: 121,789,397		probably null	Het
Kcna6	A	G	6: 126,738,798	L376P	probably damaging	Het
Kcne3	C	G	7: 100,184,313	R46G	probably benign	Het
Kcnq2	T	C	2: 181,081,141	D842G	probably damaging	Het
Klhl12	A	T	1: 134,458,481	I4F	probably benign	Het
Kpna1	T	A	16: 36,033,865	I525N	probably benign	Het
Krtap31-1	T	C	11: 99,908,123	C51R	possibly damaging	Het
Ms4a12	C	T	19: 11,230,359	G61D	possibly damaging	Het
Nol4	T	C	18: 22,823,343	N115D		Het
Pcdh15	A	G	10: 74,453,995	Y882C	probably damaging	Het
Pde8b	T	A	13: 95,107,694	H79L	probably benign	Het
Pdia2	T	C	17: 26,198,233	E79G	probably benign	Het
Pgap1	A	T	1: 54,551,008	F90L	probably damaging	Het
Pik3cd	T	A	4: 149,657,269	T407S	probably benign	Het
Pkd1l2	G	T	8: 116,998,088	F2361L	possibly damaging	Het
Pla2g12b	A	T	10: 59,410,994	R77*	probably null	Het
Ppfia2	A	G	10: 106,819,538	Y322C	probably damaging	Het
Psg23	T	C	7: 18,607,183	Q382R	possibly damaging	Het
Ptprq	A	G	10: 107,710,623	V270A	probably benign	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Robo2	T	C	16: 73,898,950	E1431G	probably benign	Het
Sdk2	A	G	11: 113,873,201	I253T	possibly damaging	Het
Sox9	A	C	11: 112,784,809	I275L	probably benign	Het
Tlr4	A	G	4: 66,839,821	I284V	probably benign	Het
Unc13b	A	G	4: 43,171,860	D896G	unknown	Het
Usp48	A	T	4: 137,644,428	H955L	probably damaging	Het
Vps54	T	C	11: 21,263,307	I30T	probably benign	Het
Zmym4	A	T	4: 126,889,539	D1169E	possibly damaging	Het
Zscan2	T	A	7: 80,875,700	Y390N	probably damaging	Het

Other mutations in Zfp106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Zfp106	APN	2	120539497	missense	probably benign	0.45
IGL00816:Zfp106	APN	2	120526848	missense	probably benign	0.02
IGL00822:Zfp106	APN	2	120514160	missense	probably damaging	1.00
IGL00848:Zfp106	APN	2	120512727	missense	probably damaging	1.00
IGL01293:Zfp106	APN	2	120535035	missense	possibly damaging	0.92
IGL01323:Zfp106	APN	2	120524464	missense	possibly damaging	0.74
IGL01662:Zfp106	APN	2	120523553	missense	probably benign	0.17
IGL01683:Zfp106	APN	2	120524555	missense	probably benign	0.00
IGL01809:Zfp106	APN	2	120533671	missense	probably damaging	1.00
IGL01958:Zfp106	APN	2	120534807	missense	probably benign	0.26
IGL01960:Zfp106	APN	2	120524043	missense	probably damaging	0.99
IGL01960:Zfp106	APN	2	120539322	missense	probably benign	0.08
IGL02168:Zfp106	APN	2	120534231	missense	possibly damaging	0.90
IGL02623:Zfp106	APN	2	120545914	splice site	probably null
IGL02798:Zfp106	APN	2	120510510	missense	probably damaging	1.00
IGL02828:Zfp106	APN	2	120531697	missense	possibly damaging	0.86
IGL03022:Zfp106	APN	2	120528639	splice site	probably benign
IGL03308:Zfp106	APN	2	120524024	missense	probably benign	0.00
IGL03324:Zfp106	APN	2	120535387	missense	probably benign	0.01
lepton	UTSW	2	120532104	missense	probably damaging	0.98
Proton	UTSW	2	120510534	missense	probably damaging	1.00
quark	UTSW	2	120535060	nonsense	probably null
R0040_zfp106_031	UTSW	2	120531613	missense	probably damaging	1.00
string	UTSW	2	120533594	missense	probably damaging	0.96
theory	UTSW	2	120533677	nonsense	probably null
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0135:Zfp106	UTSW	2	120520487	missense	probably damaging	0.99
R0180:Zfp106	UTSW	2	120533875	missense	probably damaging	0.96
R0387:Zfp106	UTSW	2	120528472	splice site	probably null
R0558:Zfp106	UTSW	2	120532196	missense	probably damaging	1.00
R0680:Zfp106	UTSW	2	120527016	missense	probably damaging	1.00
R0729:Zfp106	UTSW	2	120555248	missense	probably damaging	0.99
R0828:Zfp106	UTSW	2	120535603	missense	probably benign	0.00
R1124:Zfp106	UTSW	2	120534714	missense	probably benign	0.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1226:Zfp106	UTSW	2	120524079	missense	probably damaging	1.00
R1239:Zfp106	UTSW	2	120533594	missense	probably damaging	0.96
R1634:Zfp106	UTSW	2	120533677	nonsense	probably null
R1754:Zfp106	UTSW	2	120533763	missense	probably damaging	0.96
R1754:Zfp106	UTSW	2	120533764	missense	probably damaging	0.98
R1755:Zfp106	UTSW	2	120535175	missense	probably damaging	1.00
R1763:Zfp106	UTSW	2	120520428	missense	probably benign	0.03
R1875:Zfp106	UTSW	2	120513615	critical splice donor site	probably null
R1903:Zfp106	UTSW	2	120526848	missense	probably benign	0.02
R1932:Zfp106	UTSW	2	120531681	missense	possibly damaging	0.80
R2070:Zfp106	UTSW	2	120523529	missense	probably benign	0.11
R2301:Zfp106	UTSW	2	120535650	missense	probably benign	0.04
R3429:Zfp106	UTSW	2	120527063	missense	probably benign	0.00
R3720:Zfp106	UTSW	2	120534599	missense	probably benign	0.01
R3875:Zfp106	UTSW	2	120534613	missense	probably benign	0.08
R3881:Zfp106	UTSW	2	120532149	missense	probably benign	0.01
R3921:Zfp106	UTSW	2	120533616	missense	probably damaging	1.00
R3923:Zfp106	UTSW	2	120534856	missense	probably damaging	0.99
R4087:Zfp106	UTSW	2	120526899	splice site	probably null
R4678:Zfp106	UTSW	2	120533740	missense	probably damaging	1.00
R4965:Zfp106	UTSW	2	120533919	missense	probably damaging	0.98
R5011:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5013:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5151:Zfp106	UTSW	2	120534727	missense	probably benign	0.01
R5227:Zfp106	UTSW	2	120523968	missense	probably benign	0.11
R5328:Zfp106	UTSW	2	120520417	missense	possibly damaging	0.73
R5403:Zfp106	UTSW	2	120534781	missense	probably benign	0.02
R5624:Zfp106	UTSW	2	120531957	missense	probably damaging	0.99
R5686:Zfp106	UTSW	2	120533507	splice site	probably null
R5691:Zfp106	UTSW	2	120524471	missense	probably damaging	0.99
R5852:Zfp106	UTSW	2	120516006	missense	probably damaging	1.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6298:Zfp106	UTSW	2	120522704	missense	probably damaging	1.00
R6409:Zfp106	UTSW	2	120532104	missense	probably damaging	0.98
R6505:Zfp106	UTSW	2	120534502	missense	probably damaging	0.99
R6598:Zfp106	UTSW	2	120535060	nonsense	probably null
R6765:Zfp106	UTSW	2	120539454	missense	probably damaging	0.96
R7013:Zfp106	UTSW	2	120531632	missense	probably damaging	0.99
R7453:Zfp106	UTSW	2	120510527	missense	probably damaging	1.00
R7453:Zfp106	UTSW	2	120545919	splice site	probably null
R7643:Zfp106	UTSW	2	120512734	missense	probably benign	0.01
R7829:Zfp106	UTSW	2	120524057	missense	possibly damaging	0.94
R7909:Zfp106	UTSW	2	120514219	missense	probably damaging	1.00
R8054:Zfp106	UTSW	2	120524519	missense	possibly damaging	0.93
R8124:Zfp106	UTSW	2	120524331	missense	probably benign	0.44
R8203:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R8350:Zfp106	UTSW	2	120535618	missense
R8450:Zfp106	UTSW	2	120535618	missense
R8698:Zfp106	UTSW	2	120524119	critical splice donor site	probably null
R8985:Zfp106	UTSW	2	120535596	missense
R9015:Zfp106	UTSW	2	120533538	missense	probably damaging	1.00
R9036:Zfp106	UTSW	2	120539425	missense	probably damaging	1.00
R9142:Zfp106	UTSW	2	120520454	missense	probably damaging	1.00
R9154:Zfp106	UTSW	2	120534331	nonsense	probably null
R9175:Zfp106	UTSW	2	120522716	missense	probably damaging	1.00
R9529:Zfp106	UTSW	2	120520526	missense	probably damaging	0.97
R9572:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R9581:Zfp106	UTSW	2	120535326	missense
RF008:Zfp106	UTSW	2	120524545	small deletion	probably benign
RF025:Zfp106	UTSW	2	120524545	small deletion	probably benign
X0025:Zfp106	UTSW	2	120534816	missense	probably benign
Z1088:Zfp106	UTSW	2	120530490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTCCTCCAGAATTGCTATG -3'
(R):5'- GGGAAAGATAGTCTGCTACATTCC -3'

Sequencing Primer
(F):5'- TGAAGAGCCTCTTGTAGCAC -3'
(R):5'- AGATAGTCTGCTACATTCCAGATG -3'

Posted On

2019-12-20