Incidental Mutation 'R7897:Kcnq2'
ID609736
Institutional Source Beutler Lab
Gene Symbol Kcnq2
Ensembl Gene ENSMUSG00000016346
Gene Namepotassium voltage-gated channel, subfamily Q, member 2
SynonymsKQT2, Nmf134
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7897 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181075579-181135300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181081141 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 842 (D842G)
Ref Sequence ENSEMBL: ENSMUSP00000122915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016491] [ENSMUST00000049792] [ENSMUST00000081528] [ENSMUST00000103047] [ENSMUST00000103048] [ENSMUST00000103050] [ENSMUST00000103051] [ENSMUST00000129695] [ENSMUST00000149964] [ENSMUST00000197015]
Predicted Effect probably benign
Transcript: ENSMUST00000016491
SMART Domains Protein: ENSMUSP00000016491
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.3e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 595 2e-59 PFAM
Pfam:KCNQ_channel 593 673 1.7e-22 PFAM
low complexity region 711 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049792
SMART Domains Protein: ENSMUSP00000052453
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.2e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 565 3.1e-55 PFAM
Pfam:KCNQ_channel 587 668 6.8e-23 PFAM
low complexity region 706 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081528
SMART Domains Protein: ENSMUSP00000080243
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 4.3e-29 PFAM
Pfam:Ion_trans_2 237 317 1.7e-14 PFAM
Pfam:KCNQ_channel 436 564 2.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103047
SMART Domains Protein: ENSMUSP00000099336
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.1e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 424 583 2e-59 PFAM
Pfam:KCNQ_channel 581 661 1.7e-22 PFAM
low complexity region 699 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103048
SMART Domains Protein: ENSMUSP00000099337
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 6.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.4e-14 PFAM
Pfam:KCNQ_channel 436 637 1.3e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000099338
Gene: ENSMUSG00000016346
AA Change: D766G

DomainStartEndE-ValueType
Pfam:Ion_trans 35 268 3.7e-32 PFAM
Pfam:Ion_trans_2 181 261 1.1e-14 PFAM
Pfam:KCNQ_channel 392 584 1e-92 PFAM
Pfam:KCNQ2_u3 591 679 3.9e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 692 791 1.1e-48 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000099339
Gene: ENSMUSG00000016346
AA Change: D811G

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103051
AA Change: D824G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099340
Gene: ENSMUSG00000016346
AA Change: D824G

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.9e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 446 647 1.7e-82 PFAM
low complexity region 685 697 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 747 849 1.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129695
AA Change: D698G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123488
Gene: ENSMUSG00000016346
AA Change: D698G

DomainStartEndE-ValueType
Pfam:Ion_trans 14 198 6.8e-29 PFAM
Pfam:Ion_trans_2 123 203 2.4e-14 PFAM
Pfam:KCNQ_channel 320 521 1.3e-82 PFAM
low complexity region 559 571 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 621 723 1.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149964
AA Change: D842G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122915
Gene: ENSMUSG00000016346
AA Change: D842G

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 4.4e-32 PFAM
Pfam:Ion_trans_2 237 317 1.3e-14 PFAM
low complexity region 418 431 N/A INTRINSIC
Pfam:KCNQ_channel 466 659 6.2e-94 PFAM
Pfam:KCNQ2_u3 666 754 4.5e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 767 866 1.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197015
AA Change: D814G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143263
Gene: ENSMUSG00000016346
AA Change: D814G

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197599
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die perinatally with pulmonary atelectasis. Heterozygous mice exhibit a hypersensitivity to the epileptic inducer pentylenetetrazole. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Kcnq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Kcnq2 APN 2 181109789 unclassified probably benign
IGL02064:Kcnq2 APN 2 181109026 missense probably damaging 1.00
IGL02231:Kcnq2 APN 2 181081715 missense probably benign 0.22
IGL02261:Kcnq2 APN 2 181081690 missense probably damaging 0.98
IGL02510:Kcnq2 APN 2 181081361 missense probably benign
IGL02583:Kcnq2 APN 2 181081502 missense probably benign 0.01
IGL02627:Kcnq2 APN 2 181082327 unclassified probably benign
IGL03303:Kcnq2 APN 2 181082389 missense probably benign
R0269:Kcnq2 UTSW 2 181096974 missense probably benign 0.00
R1535:Kcnq2 UTSW 2 181134825 missense probably damaging 1.00
R1688:Kcnq2 UTSW 2 181087033 missense probably damaging 1.00
R1776:Kcnq2 UTSW 2 181100557 missense probably benign 0.01
R1946:Kcnq2 UTSW 2 181088451 missense probably benign 0.09
R2105:Kcnq2 UTSW 2 181081352 missense probably benign 0.03
R2382:Kcnq2 UTSW 2 181112107 missense probably damaging 1.00
R2912:Kcnq2 UTSW 2 181081774 missense probably damaging 1.00
R3826:Kcnq2 UTSW 2 181104900 missense possibly damaging 0.56
R3898:Kcnq2 UTSW 2 181109686 missense probably damaging 0.97
R4282:Kcnq2 UTSW 2 181081153 missense probably damaging 1.00
R4938:Kcnq2 UTSW 2 181086973 missense probably damaging 0.96
R4962:Kcnq2 UTSW 2 181112043 missense possibly damaging 0.59
R5055:Kcnq2 UTSW 2 181086761 intron probably benign
R5107:Kcnq2 UTSW 2 181108547 intron probably benign
R5371:Kcnq2 UTSW 2 181135020 missense probably damaging 1.00
R5557:Kcnq2 UTSW 2 181134897 missense probably benign 0.07
R5839:Kcnq2 UTSW 2 181109751 missense probably damaging 1.00
R5998:Kcnq2 UTSW 2 181087008 missense probably damaging 1.00
R6084:Kcnq2 UTSW 2 181087656 missense possibly damaging 0.53
R6207:Kcnq2 UTSW 2 181113233 missense possibly damaging 0.49
R6744:Kcnq2 UTSW 2 181085306 missense possibly damaging 0.94
R7018:Kcnq2 UTSW 2 181081724 nonsense probably null
R7266:Kcnq2 UTSW 2 181135092 start codon destroyed probably null 0.92
R7291:Kcnq2 UTSW 2 181088379 missense possibly damaging 0.69
R7319:Kcnq2 UTSW 2 181109102 missense probably damaging 1.00
R7447:Kcnq2 UTSW 2 181113094 missense probably damaging 0.97
R7573:Kcnq2 UTSW 2 181081589 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCAGATCCCATGAGCATC -3'
(R):5'- GATAGCGACACGTCCATCTC -3'

Sequencing Primer
(F):5'- TGTCACTCTGTCACTTTAAGAAAGGC -3'
(R):5'- CCATCCCTTCGGTGGACCATG -3'
Posted On2019-12-20