Incidental Mutation 'R7897:Tlr4'
ID609739
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7897 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66839821 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 284 (I284V)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048096
AA Change: I284V

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: I284V

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
salvador UTSW 4 66840206 missense probably damaging 0.99
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
R7139:Tlr4 UTSW 4 66840283 missense probably benign 0.06
R7199:Tlr4 UTSW 4 66841193 missense probably damaging 0.99
R7220:Tlr4 UTSW 4 66839951 missense probably benign
R7337:Tlr4 UTSW 4 66839954 missense possibly damaging 0.86
R7487:Tlr4 UTSW 4 66924422 missense probably benign 0.00
R7638:Tlr4 UTSW 4 66840206 missense probably damaging 0.99
R7773:Tlr4 UTSW 4 66839599 missense probably damaging 1.00
R7814:Tlr4 UTSW 4 66841079 missense probably damaging 1.00
R7980:Tlr4 UTSW 4 66839821 missense probably benign 0.07
R8044:Tlr4 UTSW 4 66827847 missense probably benign 0.01
R8062:Tlr4 UTSW 4 66839850 missense probably benign 0.00
R8080:Tlr4 UTSW 4 66839476 missense probably damaging 1.00
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATTGACTTCATTCAAGACCAAGCC -3'
(R):5'- CCAGAGTTGGAAACTGCTTAAGTTG -3'

Sequencing Primer
(F):5'- GCCTTTCAGGGAATTAAGCTCCATG -3'
(R):5'- TACACCTGCCAGAGACAT -3'
Posted On2019-12-20