Incidental Mutation 'R7897:Usp48'
ID 609741
Institutional Source Beutler Lab
Gene Symbol Usp48
Ensembl Gene ENSMUSG00000043411
Gene Name ubiquitin specific peptidase 48
Synonyms Usp31, D330022K21Rik, 2810449C13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 137593755-137658537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 137644428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 955 (H955L)
Ref Sequence ENSEMBL: ENSMUSP00000055016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105840] [ENSMUST00000141628]
AlphaFold Q3V0C5
Predicted Effect probably damaging
Transcript: ENSMUST00000055131
AA Change: H955L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: H955L

DomainStartEndE-ValueType
Pfam:UCH 88 417 6.9e-44 PFAM
Pfam:UCH_1 89 374 1e-22 PFAM
Blast:DUSP 479 555 5e-39 BLAST
coiled coil region 622 643 N/A INTRINSIC
UBQ 954 1022 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105840
AA Change: H939L

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: H939L

DomainStartEndE-ValueType
Pfam:UCH 88 418 6.4e-49 PFAM
Pfam:UCH_1 89 374 1.8e-27 PFAM
Blast:DUSP 480 556 4e-39 BLAST
coiled coil region 624 645 N/A INTRINSIC
Blast:DUSP 743 824 2e-7 BLAST
UBQ 938 1006 4.78e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118084
Gene: ENSMUSG00000043411
AA Change: H63L

DomainStartEndE-ValueType
UBQ 63 131 4.78e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141628
AA Change: H186L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119691
Gene: ENSMUSG00000043411
AA Change: H186L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
UBQ 185 253 4.78e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115526
Gene: ENSMUSG00000043411
AA Change: H29L

DomainStartEndE-ValueType
UBQ 29 97 4.78e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117989
Gene: ENSMUSG00000043411
AA Change: H1L

DomainStartEndE-ValueType
UBQ 1 69 9.53e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Usp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Usp48 APN 4 137623272 critical splice acceptor site probably null
IGL01864:Usp48 APN 4 137639227 missense possibly damaging 0.87
IGL02386:Usp48 APN 4 137604523 missense possibly damaging 0.93
IGL03112:Usp48 APN 4 137608064 missense probably damaging 1.00
IGL03114:Usp48 APN 4 137656125 missense probably damaging 1.00
IGL03406:Usp48 APN 4 137639295 missense possibly damaging 0.90
balfour UTSW 4 137633455 missense probably benign 0.00
burlap UTSW 4 137625276 missense possibly damaging 0.77
fulfillment UTSW 4 137638233 missense probably damaging 1.00
hayao UTSW 4 137633439 nonsense probably null
Mei UTSW 4 137606693 nonsense probably null
miyazaki UTSW 4 137608154 missense probably damaging 1.00
promise UTSW 4 137634921 missense probably damaging 1.00
satsuki UTSW 4 137633126 missense possibly damaging 0.93
Totoro UTSW 4 137594483 missense probably damaging 0.99
IGL02796:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R0050:Usp48 UTSW 4 137613803 missense probably damaging 1.00
R0333:Usp48 UTSW 4 137594483 missense probably damaging 0.99
R0382:Usp48 UTSW 4 137621218 missense probably benign 0.00
R0423:Usp48 UTSW 4 137616411 missense probably benign
R0570:Usp48 UTSW 4 137633126 missense possibly damaging 0.93
R0855:Usp48 UTSW 4 137608154 missense probably damaging 1.00
R0943:Usp48 UTSW 4 137644470 missense possibly damaging 0.92
R1367:Usp48 UTSW 4 137639295 missense possibly damaging 0.90
R1367:Usp48 UTSW 4 137644463 missense probably damaging 1.00
R1689:Usp48 UTSW 4 137656107 splice site probably null
R1725:Usp48 UTSW 4 137633422 nonsense probably null
R2520:Usp48 UTSW 4 137625251 missense probably benign 0.05
R2965:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R2966:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R3026:Usp48 UTSW 4 137594444 missense probably benign 0.06
R3963:Usp48 UTSW 4 137633439 nonsense probably null
R4087:Usp48 UTSW 4 137623340 missense possibly damaging 0.95
R4633:Usp48 UTSW 4 137634900 missense probably damaging 0.96
R4677:Usp48 UTSW 4 137616381 missense probably benign 0.16
R4735:Usp48 UTSW 4 137633369 nonsense probably null
R4932:Usp48 UTSW 4 137615833 missense probably benign 0.00
R4932:Usp48 UTSW 4 137615834 splice site probably null
R4935:Usp48 UTSW 4 137650358 missense probably benign 0.42
R4952:Usp48 UTSW 4 137606693 nonsense probably null
R5034:Usp48 UTSW 4 137606757 nonsense probably null
R5153:Usp48 UTSW 4 137616362 missense possibly damaging 0.68
R5443:Usp48 UTSW 4 137621221 missense possibly damaging 0.78
R5591:Usp48 UTSW 4 137652652 intron probably benign
R5825:Usp48 UTSW 4 137623378 missense probably benign
R5889:Usp48 UTSW 4 137616412 missense probably benign
R5955:Usp48 UTSW 4 137615818 missense probably benign
R6089:Usp48 UTSW 4 137605818 missense probably damaging 1.00
R6443:Usp48 UTSW 4 137613763 missense probably damaging 1.00
R6473:Usp48 UTSW 4 137609108 critical splice donor site probably null
R6482:Usp48 UTSW 4 137634921 missense probably damaging 1.00
R6859:Usp48 UTSW 4 137625276 missense possibly damaging 0.77
R6916:Usp48 UTSW 4 137638233 missense probably damaging 1.00
R6977:Usp48 UTSW 4 137650360 missense probably damaging 1.00
R7749:Usp48 UTSW 4 137650417 missense probably damaging 1.00
R7759:Usp48 UTSW 4 137594452 missense probably benign 0.25
R7767:Usp48 UTSW 4 137604645 critical splice donor site probably null
R7850:Usp48 UTSW 4 137605749 splice site probably null
R7881:Usp48 UTSW 4 137633455 missense probably benign 0.00
R8186:Usp48 UTSW 4 137621196 missense possibly damaging 0.83
R8198:Usp48 UTSW 4 137621159 unclassified probably benign
R8353:Usp48 UTSW 4 137623382 missense probably benign 0.00
R8466:Usp48 UTSW 4 137623319 missense probably null 1.00
R8506:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R8821:Usp48 UTSW 4 137613769 missense probably damaging 1.00
R8831:Usp48 UTSW 4 137613769 missense probably damaging 1.00
R8911:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9043:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9044:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9289:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9295:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9296:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9297:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9317:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9460:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9480:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9481:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9520:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9521:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9522:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9627:Usp48 UTSW 4 137613685 missense probably benign 0.00
R9698:Usp48 UTSW 4 137633891 missense possibly damaging 0.94
R9752:Usp48 UTSW 4 137613826 missense probably damaging 1.00
R9784:Usp48 UTSW 4 137594501 missense probably benign 0.06
RF002:Usp48 UTSW 4 137605795 missense probably damaging 1.00
Z1176:Usp48 UTSW 4 137604637 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGCACTGTGCTTGATTCAC -3'
(R):5'- TCCTCTTGGCTAACTACCACAAG -3'

Sequencing Primer
(F):5'- CTTGATTCACAGGGTTTCAGGAG -3'
(R):5'- AGCTCCAGGAAACAGGTT -3'
Posted On 2019-12-20