Incidental Mutation 'R7897:Afm'
ID 609745
Institutional Source Beutler Lab
Gene Symbol Afm
Ensembl Gene ENSMUSG00000029369
Gene Name afamin
Synonyms alpha albumin, Alf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 90518932-90553543 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 90547868 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 411 (M411I)
Ref Sequence ENSEMBL: ENSMUSP00000108804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113179] [ENSMUST00000128740]
AlphaFold O89020
Predicted Effect probably benign
Transcript: ENSMUST00000113179
AA Change: M411I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108804
Gene: ENSMUSG00000029369
AA Change: M411I

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
ALBUMIN 404 593 3.07e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128740
AA Change: M411I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117180
Gene: ENSMUSG00000029369
AA Change: M411I

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Afm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Afm APN 5 90525591 missense probably benign 0.01
IGL01140:Afm APN 5 90524867 missense probably damaging 1.00
IGL01789:Afm APN 5 90525584 missense probably benign 0.32
IGL01819:Afm APN 5 90524906 missense probably benign 0.01
IGL01826:Afm APN 5 90524928 splice site probably benign
IGL01875:Afm APN 5 90548883 utr 3 prime probably benign
IGL02337:Afm APN 5 90547911 missense probably benign
IGL02902:Afm APN 5 90526363 missense possibly damaging 0.58
IGL02950:Afm APN 5 90531607 missense probably damaging 1.00
R0009:Afm UTSW 5 90545384 splice site probably benign
R0009:Afm UTSW 5 90545384 splice site probably benign
R0135:Afm UTSW 5 90550322 missense probably benign 0.00
R0582:Afm UTSW 5 90524780 splice site probably benign
R1416:Afm UTSW 5 90526379 missense possibly damaging 0.74
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1834:Afm UTSW 5 90526424 missense probably benign 0.01
R1919:Afm UTSW 5 90524920 nonsense probably null
R2071:Afm UTSW 5 90523735 missense probably benign 0.17
R2843:Afm UTSW 5 90526465 nonsense probably null
R2979:Afm UTSW 5 90522163 missense probably benign 0.19
R4853:Afm UTSW 5 90551467 missense probably damaging 1.00
R5400:Afm UTSW 5 90551398 missense possibly damaging 0.86
R5551:Afm UTSW 5 90531652 missense probably null 0.97
R5583:Afm UTSW 5 90547881 missense probably damaging 1.00
R5780:Afm UTSW 5 90551431 missense possibly damaging 0.87
R7378:Afm UTSW 5 90551400 missense probably benign 0.00
R7470:Afm UTSW 5 90531627 missense probably damaging 0.99
R7785:Afm UTSW 5 90550173 missense possibly damaging 0.93
R7799:Afm UTSW 5 90523854 missense probably benign 0.00
R7809:Afm UTSW 5 90524816 missense probably damaging 1.00
R8236:Afm UTSW 5 90523888 missense probably damaging 1.00
R8497:Afm UTSW 5 90551343 critical splice acceptor site probably null
R8752:Afm UTSW 5 90552565 missense probably benign 0.00
R8949:Afm UTSW 5 90531515 nonsense probably null
R8971:Afm UTSW 5 90548816 missense probably damaging 0.99
R9013:Afm UTSW 5 90523735 missense probably damaging 0.99
R9067:Afm UTSW 5 90523815 missense probably benign 0.01
R9082:Afm UTSW 5 90550236 missense probably damaging 1.00
R9335:Afm UTSW 5 90550227 missense probably damaging 1.00
X0022:Afm UTSW 5 90545414 missense probably damaging 1.00
Z1177:Afm UTSW 5 90521946 missense probably benign 0.05
Z1177:Afm UTSW 5 90531506 missense probably benign 0.07
Z1177:Afm UTSW 5 90531616 missense probably damaging 1.00
Z1177:Afm UTSW 5 90551383 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATAAGCTACTGTGGTTCTCATCTG -3'
(R):5'- AGAAGGCTCAGTGGGAATTC -3'

Sequencing Primer
(F):5'- TCTGTGGATGAATAAGAGCGC -3'
(R):5'- AAGGCTCAGTGGGAATTCTTGAC -3'
Posted On 2019-12-20