Incidental Mutation 'R7897:Kcna6'
ID 609747
Institutional Source Beutler Lab
Gene Symbol Kcna6
Ensembl Gene ENSMUSG00000038077
Gene Name potassium voltage-gated channel, shaker-related, subfamily, member 6
Synonyms MK1.6, Kv1.6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 126708329-126740674 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126738798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 376 (L376P)
Ref Sequence ENSEMBL: ENSMUSP00000139481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040751] [ENSMUST00000112242] [ENSMUST00000185333]
AlphaFold Q61923
Predicted Effect probably damaging
Transcript: ENSMUST00000040751
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036872
Gene: ENSMUSG00000038077
AA Change: L376P

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112242
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107861
Gene: ENSMUSG00000038077
AA Change: L376P

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
Pfam:Ion_trans 173 469 6.1e-52 PFAM
Pfam:Ion_trans_2 377 462 3.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185333
AA Change: L376P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139481
Gene: ENSMUSG00000038077
AA Change: L376P

DomainStartEndE-ValueType
BTB 41 141 3.64e-9 SMART
transmembrane domain 175 197 N/A INTRINSIC
low complexity region 223 230 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
Pfam:Ion_trans 265 457 3.6e-36 PFAM
Pfam:Ion_trans_2 377 462 8.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class. The coding region of this gene is intronless, and the gene is clustered with genes KCNA1 and KCNA5 on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased thermal nociceptive threshold and in females an increase in circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Kcna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL01623:Kcna6 APN 6 126738613 missense probably damaging 1.00
IGL02385:Kcna6 APN 6 126738954 missense probably benign
IGL02452:Kcna6 APN 6 126738480 missense possibly damaging 0.57
IGL02480:Kcna6 APN 6 126738568 missense probably damaging 1.00
IGL02604:Kcna6 APN 6 126739204 missense probably benign 0.17
IGL02794:Kcna6 APN 6 126738552 missense probably damaging 1.00
R1599:Kcna6 UTSW 6 126739319 missense probably benign 0.00
R1932:Kcna6 UTSW 6 126738488 missense probably benign 0.16
R1984:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R1985:Kcna6 UTSW 6 126738510 missense probably benign 0.34
R2114:Kcna6 UTSW 6 126739359 missense possibly damaging 0.93
R4111:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4112:Kcna6 UTSW 6 126739774 missense probably damaging 1.00
R4793:Kcna6 UTSW 6 126738556 missense probably damaging 1.00
R4818:Kcna6 UTSW 6 126738424 missense probably benign 0.00
R4884:Kcna6 UTSW 6 126738726 missense probably benign 0.08
R5126:Kcna6 UTSW 6 126738732 missense probably damaging 1.00
R5754:Kcna6 UTSW 6 126739725 missense probably damaging 1.00
R6074:Kcna6 UTSW 6 126739279 missense probably benign
R7332:Kcna6 UTSW 6 126739329 missense possibly damaging 0.89
R7766:Kcna6 UTSW 6 126739719 missense probably damaging 1.00
R7846:Kcna6 UTSW 6 126739020 missense probably damaging 1.00
R8000:Kcna6 UTSW 6 126738985 nonsense probably null
R8097:Kcna6 UTSW 6 126738612 missense probably damaging 1.00
R8920:Kcna6 UTSW 6 126739647 missense probably damaging 1.00
R9477:Kcna6 UTSW 6 126739398 missense probably damaging 1.00
R9645:Kcna6 UTSW 6 126739059 missense probably benign 0.01
R9662:Kcna6 UTSW 6 126738417 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TAATGCAATGGTGAGGACCC -3'
(R):5'- TAGTGCAACGTCACGAGCAG -3'

Sequencing Primer
(F):5'- GTGAGCCCACAATCTTGCC -3'
(R):5'- TCACGAGCAGCAGTCTGTGAG -3'
Posted On 2019-12-20