Incidental Mutation 'R7897:Pkd1l2'
ID609753
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Namepolycystic kidney disease 1 like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7897 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location116995679-117082449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116998088 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2361 (F2361L)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040484] [ENSMUST00000098375] [ENSMUST00000109093]
Predicted Effect probably benign
Transcript: ENSMUST00000040484
SMART Domains Protein: ENSMUSP00000037131
Gene: ENSMUSG00000034424

DomainStartEndE-ValueType
Pfam:GCV_H 48 168 1.2e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098375
AA Change: F2360L

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: F2360L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109093
AA Change: F2361L

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: F2361L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Kpna1 T A 16: 36,033,865 I525N probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117068110 missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117060594 missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117065529 missense probably benign
R7590:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117029645 missense probably damaging 1.00
R7768:Pkd1l2 UTSW 8 117054860 critical splice donor site probably null
R7982:Pkd1l2 UTSW 8 117051187 missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117076182 missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117047497 missense probably benign
R8145:Pkd1l2 UTSW 8 117055003 missense probably benign
R8228:Pkd1l2 UTSW 8 117065775 missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117040733 missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117047563 critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117065572 missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 116999921 missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117013876 missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 116999978 missense possibly damaging 0.52
Z1176:Pkd1l2 UTSW 8 117054914 missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117030691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTACAGCTCAGCATGGC -3'
(R):5'- TCTCAAACATCAGAACTGGAGGG -3'

Sequencing Primer
(F):5'- CCCTCCAGTGGCTCTGATAG -3'
(R):5'- CATCAGAACTGGAGGGGTGGC -3'
Posted On2019-12-20