Incidental Mutation 'R7897:Jmjd1c'
ID 609761
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Name jumonji domain containing 1C
Synonyms D630035I23Rik, TRIP8, 5430433L24Rik
MMRRC Submission 045949-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.662) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 66932189-67092105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67075644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1837 (N1837S)
Ref Sequence ENSEMBL: ENSMUSP00000133700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174408]
AlphaFold Q69ZK6
Predicted Effect probably damaging
Transcript: ENSMUST00000051446
AA Change: N2017S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: N2017S

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173689
AA Change: N1837S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: N1837S

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174408
AA Change: N2018S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: N2018S

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 TGTTGATCCATA T 2: 69,154,216 (GRCm39) probably null Het
Abcb11 GTTGATCCATACA G 2: 69,154,217 (GRCm39) probably benign Het
Abcc10 T C 17: 46,634,999 (GRCm39) T335A probably benign Het
Actr3b T C 5: 26,036,657 (GRCm39) Y245H probably benign Het
Afm G A 5: 90,695,727 (GRCm39) M411I probably benign Het
Ahr T C 12: 35,554,169 (GRCm39) N650S possibly damaging Het
Ap5m1 A G 14: 49,311,232 (GRCm39) R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 134,646,453 (GRCm39) probably benign Het
Atp13a4 T C 16: 29,215,284 (GRCm39) Q1151R Het
Bcl9 A G 3: 97,112,567 (GRCm39) V1296A possibly damaging Het
Bsn A C 9: 107,989,065 (GRCm39) M2229R probably damaging Het
Cfap74 T C 4: 155,514,351 (GRCm39) V529A Het
Clip1 C T 5: 123,760,861 (GRCm39) V767M probably benign Het
Col6a5 A G 9: 105,766,382 (GRCm39) I1846T possibly damaging Het
Crisp1 A T 17: 40,618,656 (GRCm39) D68E probably benign Het
Csmd1 A T 8: 17,584,935 (GRCm39) L19Q possibly damaging Het
Cul7 T C 17: 46,968,931 (GRCm39) I892T probably benign Het
Efcab3 A T 11: 104,889,061 (GRCm39) Y4159F probably benign Het
Elavl3 G A 9: 21,929,846 (GRCm39) R353C probably damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fbxo3 A G 2: 103,883,757 (GRCm39) D327G possibly damaging Het
Galr1 T C 18: 82,424,256 (GRCm39) N7S probably benign Het
Glyatl3 T C 17: 41,215,802 (GRCm39) T235A probably damaging Het
Gm5145 A C 17: 20,790,967 (GRCm39) Q115P probably benign Het
Grm5 T C 7: 87,780,069 (GRCm39) S1202P probably benign Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Jph3 A T 8: 122,516,136 (GRCm39) probably null Het
Kcna6 A G 6: 126,715,761 (GRCm39) L376P probably damaging Het
Kcne3 C G 7: 99,833,520 (GRCm39) R46G probably benign Het
Kcnq2 T C 2: 180,722,934 (GRCm39) D842G probably damaging Het
Klhl12 A T 1: 134,386,219 (GRCm39) I4F probably benign Het
Kpna1 T A 16: 35,854,235 (GRCm39) I525N probably benign Het
Krtap31-1 T C 11: 99,798,949 (GRCm39) C51R possibly damaging Het
Ms4a12 C T 19: 11,207,723 (GRCm39) G61D possibly damaging Het
Nol4 T C 18: 22,956,400 (GRCm39) N115D Het
Nudt16l2 A C 9: 105,021,709 (GRCm39) Y112* probably null Het
Pcdh15 A G 10: 74,289,827 (GRCm39) Y882C probably damaging Het
Pde8b T A 13: 95,244,202 (GRCm39) H79L probably benign Het
Pdia2 T C 17: 26,417,207 (GRCm39) E79G probably benign Het
Pgap1 A T 1: 54,590,167 (GRCm39) F90L probably damaging Het
Pik3cd T A 4: 149,741,726 (GRCm39) T407S probably benign Het
Pkd1l2 G T 8: 117,724,827 (GRCm39) F2361L possibly damaging Het
Pla2g12b A T 10: 59,246,816 (GRCm39) R77* probably null Het
Ppfia2 A G 10: 106,655,399 (GRCm39) Y322C probably damaging Het
Psg23 T C 7: 18,341,108 (GRCm39) Q382R possibly damaging Het
Ptprq A G 10: 107,546,484 (GRCm39) V270A probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Robo2 T C 16: 73,695,838 (GRCm39) E1431G probably benign Het
Sdk2 A G 11: 113,764,027 (GRCm39) I253T possibly damaging Het
Sox9 A C 11: 112,675,635 (GRCm39) I275L probably benign Het
Tlr4 A G 4: 66,758,058 (GRCm39) I284V probably benign Het
Unc13b A G 4: 43,171,860 (GRCm39) D896G unknown Het
Usp48 A T 4: 137,371,739 (GRCm39) H955L probably damaging Het
Vps54 T C 11: 21,213,307 (GRCm39) I30T probably benign Het
Zfp106 G A 2: 120,366,096 (GRCm39) R59* probably null Het
Zmym4 A T 4: 126,783,332 (GRCm39) D1169E possibly damaging Het
Zscan2 T A 7: 80,525,448 (GRCm39) Y390N probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67,062,494 (GRCm39) missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67,085,541 (GRCm39) missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67,067,794 (GRCm39) missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67,055,305 (GRCm39) missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67,079,648 (GRCm39) missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67,056,171 (GRCm39) missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67,056,101 (GRCm39) missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67,062,161 (GRCm39) missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67,061,640 (GRCm39) missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67,061,115 (GRCm39) missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67,055,433 (GRCm39) missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67,061,277 (GRCm39) missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67,067,849 (GRCm39) missense probably damaging 0.99
Accordion UTSW 10 67,069,193 (GRCm39) missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67,065,692 (GRCm39) missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67,055,105 (GRCm39) missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67,076,587 (GRCm39) missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67,054,888 (GRCm39) missense unknown
R0396:Jmjd1c UTSW 10 67,055,302 (GRCm39) missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67,056,161 (GRCm39) missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67,091,261 (GRCm39) missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67,076,506 (GRCm39) missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67,061,534 (GRCm39) missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67,061,568 (GRCm39) missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67,062,588 (GRCm39) missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67,054,725 (GRCm39) splice site probably null
R0755:Jmjd1c UTSW 10 66,932,378 (GRCm39) intron probably benign
R1142:Jmjd1c UTSW 10 67,061,124 (GRCm39) missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67,075,015 (GRCm39) splice site probably benign
R1413:Jmjd1c UTSW 10 67,085,529 (GRCm39) missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67,055,654 (GRCm39) missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67,060,588 (GRCm39) missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67,061,469 (GRCm39) missense probably benign
R1950:Jmjd1c UTSW 10 67,075,701 (GRCm39) missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67,061,219 (GRCm39) missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 66,993,777 (GRCm39) nonsense probably null
R2061:Jmjd1c UTSW 10 67,054,205 (GRCm39) missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67,075,242 (GRCm39) splice site probably null
R2203:Jmjd1c UTSW 10 67,075,242 (GRCm39) splice site probably null
R2256:Jmjd1c UTSW 10 67,061,073 (GRCm39) missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67,074,629 (GRCm39) missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67,091,279 (GRCm39) missense probably benign
R2392:Jmjd1c UTSW 10 67,065,683 (GRCm39) missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 66,993,711 (GRCm39) missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67,075,863 (GRCm39) splice site probably benign
R4043:Jmjd1c UTSW 10 67,055,245 (GRCm39) missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67,054,787 (GRCm39) missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67,055,532 (GRCm39) missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 66,932,460 (GRCm39) intron probably benign
R4352:Jmjd1c UTSW 10 67,080,588 (GRCm39) missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67,085,529 (GRCm39) missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 66,993,753 (GRCm39) nonsense probably null
R4717:Jmjd1c UTSW 10 66,993,830 (GRCm39) nonsense probably null
R4741:Jmjd1c UTSW 10 67,060,718 (GRCm39) missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67,060,571 (GRCm39) missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67,069,225 (GRCm39) missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67,054,750 (GRCm39) missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67,081,916 (GRCm39) missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67,067,795 (GRCm39) missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67,076,480 (GRCm39) missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67,053,928 (GRCm39) missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67,085,541 (GRCm39) missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67,069,193 (GRCm39) missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67,061,857 (GRCm39) missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67,065,785 (GRCm39) missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67,056,112 (GRCm39) missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67,062,291 (GRCm39) missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67,075,791 (GRCm39) missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67,083,827 (GRCm39) missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67,056,187 (GRCm39) missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67,085,439 (GRCm39) missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67,061,718 (GRCm39) missense probably benign
R6430:Jmjd1c UTSW 10 67,059,939 (GRCm39) missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67,061,795 (GRCm39) missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67,025,599 (GRCm39) missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67,052,869 (GRCm39) missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67,056,388 (GRCm39) missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67,055,411 (GRCm39) missense probably benign 0.39
R7113:Jmjd1c UTSW 10 66,993,780 (GRCm39) missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67,061,844 (GRCm39) missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67,025,596 (GRCm39) missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67,054,143 (GRCm39) missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67,025,537 (GRCm39) missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67,052,815 (GRCm39) missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67,061,092 (GRCm39) missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67,067,794 (GRCm39) missense probably damaging 0.99
R7699:Jmjd1c UTSW 10 67,054,195 (GRCm39) missense probably benign 0.10
R7745:Jmjd1c UTSW 10 67,052,824 (GRCm39) missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67,061,621 (GRCm39) missense probably benign
R7911:Jmjd1c UTSW 10 67,067,774 (GRCm39) missense probably damaging 1.00
R7967:Jmjd1c UTSW 10 67,085,461 (GRCm39) missense probably damaging 1.00
R8058:Jmjd1c UTSW 10 67,090,274 (GRCm39) missense not run
R8224:Jmjd1c UTSW 10 67,080,628 (GRCm39) missense noncoding transcript
R8251:Jmjd1c UTSW 10 67,075,068 (GRCm39) missense noncoding transcript
R8797:Jmjd1c UTSW 10 67,060,616 (GRCm39) missense probably benign
R8833:Jmjd1c UTSW 10 67,054,162 (GRCm39) missense probably benign 0.03
R9262:Jmjd1c UTSW 10 67,083,793 (GRCm39) missense probably benign 0.39
R9354:Jmjd1c UTSW 10 67,059,875 (GRCm39) missense probably damaging 0.99
R9373:Jmjd1c UTSW 10 66,932,495 (GRCm39) intron probably benign
R9477:Jmjd1c UTSW 10 66,993,734 (GRCm39) nonsense probably null
R9519:Jmjd1c UTSW 10 66,993,798 (GRCm39) missense possibly damaging 0.80
R9701:Jmjd1c UTSW 10 67,060,745 (GRCm39) missense possibly damaging 0.94
R9802:Jmjd1c UTSW 10 67,060,745 (GRCm39) missense possibly damaging 0.94
RF011:Jmjd1c UTSW 10 67,055,978 (GRCm39) missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Z1176:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Z1177:Jmjd1c UTSW 10 67,081,904 (GRCm39) missense probably damaging 0.98
Z1177:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAAACTGGTCAGAGTACCATG -3'
(R):5'- ATTGAATATACTGGCGCAAAGG -3'

Sequencing Primer
(F):5'- AGGTCTGAGGTTCTGAGA -3'
(R):5'- GCAATGCCAGCATCTGTAGAGC -3'
Posted On 2019-12-20