Incidental Mutation 'R7897:Krtap31-1'
ID 609766
Institutional Source Beutler Lab
Gene Symbol Krtap31-1
Ensembl Gene ENSMUSG00000070334
Gene Name keratin associated protein 31-1
Synonyms 4733401H21Rik
MMRRC Submission 045949-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 99798746-99799716 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99798949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 51 (C51R)
Ref Sequence ENSEMBL: ENSMUSP00000091467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093935]
AlphaFold Q9D644
Predicted Effect possibly damaging
Transcript: ENSMUST00000093935
AA Change: C51R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091467
Gene: ENSMUSG00000070334
AA Change: C51R

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 40 56 N/A INTRINSIC
Pfam:Keratin_B2_2 64 107 1.9e-9 PFAM
Pfam:Keratin_B2_2 111 157 2.4e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 TGTTGATCCATA T 2: 69,154,216 (GRCm39) probably null Het
Abcb11 GTTGATCCATACA G 2: 69,154,217 (GRCm39) probably benign Het
Abcc10 T C 17: 46,634,999 (GRCm39) T335A probably benign Het
Actr3b T C 5: 26,036,657 (GRCm39) Y245H probably benign Het
Afm G A 5: 90,695,727 (GRCm39) M411I probably benign Het
Ahr T C 12: 35,554,169 (GRCm39) N650S possibly damaging Het
Ap5m1 A G 14: 49,311,232 (GRCm39) R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 134,646,453 (GRCm39) probably benign Het
Atp13a4 T C 16: 29,215,284 (GRCm39) Q1151R Het
Bcl9 A G 3: 97,112,567 (GRCm39) V1296A possibly damaging Het
Bsn A C 9: 107,989,065 (GRCm39) M2229R probably damaging Het
Cfap74 T C 4: 155,514,351 (GRCm39) V529A Het
Clip1 C T 5: 123,760,861 (GRCm39) V767M probably benign Het
Col6a5 A G 9: 105,766,382 (GRCm39) I1846T possibly damaging Het
Crisp1 A T 17: 40,618,656 (GRCm39) D68E probably benign Het
Csmd1 A T 8: 17,584,935 (GRCm39) L19Q possibly damaging Het
Cul7 T C 17: 46,968,931 (GRCm39) I892T probably benign Het
Efcab3 A T 11: 104,889,061 (GRCm39) Y4159F probably benign Het
Elavl3 G A 9: 21,929,846 (GRCm39) R353C probably damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fbxo3 A G 2: 103,883,757 (GRCm39) D327G possibly damaging Het
Galr1 T C 18: 82,424,256 (GRCm39) N7S probably benign Het
Glyatl3 T C 17: 41,215,802 (GRCm39) T235A probably damaging Het
Gm5145 A C 17: 20,790,967 (GRCm39) Q115P probably benign Het
Grm5 T C 7: 87,780,069 (GRCm39) S1202P probably benign Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Jmjd1c A G 10: 67,075,644 (GRCm39) N1837S probably damaging Het
Jph3 A T 8: 122,516,136 (GRCm39) probably null Het
Kcna6 A G 6: 126,715,761 (GRCm39) L376P probably damaging Het
Kcne3 C G 7: 99,833,520 (GRCm39) R46G probably benign Het
Kcnq2 T C 2: 180,722,934 (GRCm39) D842G probably damaging Het
Klhl12 A T 1: 134,386,219 (GRCm39) I4F probably benign Het
Kpna1 T A 16: 35,854,235 (GRCm39) I525N probably benign Het
Ms4a12 C T 19: 11,207,723 (GRCm39) G61D possibly damaging Het
Nol4 T C 18: 22,956,400 (GRCm39) N115D Het
Nudt16l2 A C 9: 105,021,709 (GRCm39) Y112* probably null Het
Pcdh15 A G 10: 74,289,827 (GRCm39) Y882C probably damaging Het
Pde8b T A 13: 95,244,202 (GRCm39) H79L probably benign Het
Pdia2 T C 17: 26,417,207 (GRCm39) E79G probably benign Het
Pgap1 A T 1: 54,590,167 (GRCm39) F90L probably damaging Het
Pik3cd T A 4: 149,741,726 (GRCm39) T407S probably benign Het
Pkd1l2 G T 8: 117,724,827 (GRCm39) F2361L possibly damaging Het
Pla2g12b A T 10: 59,246,816 (GRCm39) R77* probably null Het
Ppfia2 A G 10: 106,655,399 (GRCm39) Y322C probably damaging Het
Psg23 T C 7: 18,341,108 (GRCm39) Q382R possibly damaging Het
Ptprq A G 10: 107,546,484 (GRCm39) V270A probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Robo2 T C 16: 73,695,838 (GRCm39) E1431G probably benign Het
Sdk2 A G 11: 113,764,027 (GRCm39) I253T possibly damaging Het
Sox9 A C 11: 112,675,635 (GRCm39) I275L probably benign Het
Tlr4 A G 4: 66,758,058 (GRCm39) I284V probably benign Het
Unc13b A G 4: 43,171,860 (GRCm39) D896G unknown Het
Usp48 A T 4: 137,371,739 (GRCm39) H955L probably damaging Het
Vps54 T C 11: 21,213,307 (GRCm39) I30T probably benign Het
Zfp106 G A 2: 120,366,096 (GRCm39) R59* probably null Het
Zmym4 A T 4: 126,783,332 (GRCm39) D1169E possibly damaging Het
Zscan2 T A 7: 80,525,448 (GRCm39) Y390N probably damaging Het
Other mutations in Krtap31-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1608:Krtap31-1 UTSW 11 99,798,919 (GRCm39) missense probably benign 0.18
R2284:Krtap31-1 UTSW 11 99,799,081 (GRCm39) nonsense probably null
R2343:Krtap31-1 UTSW 11 99,798,847 (GRCm39) missense possibly damaging 0.86
R4072:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4074:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4076:Krtap31-1 UTSW 11 99,799,058 (GRCm39) missense possibly damaging 0.52
R4086:Krtap31-1 UTSW 11 99,799,145 (GRCm39) missense possibly damaging 0.93
R4884:Krtap31-1 UTSW 11 99,799,310 (GRCm39) missense unknown
R7644:Krtap31-1 UTSW 11 99,799,048 (GRCm39) missense possibly damaging 0.71
R7670:Krtap31-1 UTSW 11 99,799,258 (GRCm39) missense not run
R7949:Krtap31-1 UTSW 11 99,799,144 (GRCm39) missense possibly damaging 0.71
R8158:Krtap31-1 UTSW 11 99,798,901 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGGAACAGACTATCACTCTCC -3'
(R):5'- AAAGGAGGTGGTCTTGCAGC -3'

Sequencing Primer
(F):5'- GGAACAGACTATCACTCTCCACTCC -3'
(R):5'- CTTGCAGCAGCTGGTTTCACAG -3'
Posted On 2019-12-20