Incidental Mutation 'R7897:Ahr'
ID 609770
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms In, bHLHe76, dioxin receptor, Ah, Ahh, Ahre
MMRRC Submission 045949-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 35547978-35584988 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35554169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 650 (N650S)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110811
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116436
AA Change: N650S

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: N650S

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 TGTTGATCCATA T 2: 69,154,216 (GRCm39) probably null Het
Abcb11 GTTGATCCATACA G 2: 69,154,217 (GRCm39) probably benign Het
Abcc10 T C 17: 46,634,999 (GRCm39) T335A probably benign Het
Actr3b T C 5: 26,036,657 (GRCm39) Y245H probably benign Het
Afm G A 5: 90,695,727 (GRCm39) M411I probably benign Het
Ap5m1 A G 14: 49,311,232 (GRCm39) R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 134,646,453 (GRCm39) probably benign Het
Atp13a4 T C 16: 29,215,284 (GRCm39) Q1151R Het
Bcl9 A G 3: 97,112,567 (GRCm39) V1296A possibly damaging Het
Bsn A C 9: 107,989,065 (GRCm39) M2229R probably damaging Het
Cfap74 T C 4: 155,514,351 (GRCm39) V529A Het
Clip1 C T 5: 123,760,861 (GRCm39) V767M probably benign Het
Col6a5 A G 9: 105,766,382 (GRCm39) I1846T possibly damaging Het
Crisp1 A T 17: 40,618,656 (GRCm39) D68E probably benign Het
Csmd1 A T 8: 17,584,935 (GRCm39) L19Q possibly damaging Het
Cul7 T C 17: 46,968,931 (GRCm39) I892T probably benign Het
Efcab3 A T 11: 104,889,061 (GRCm39) Y4159F probably benign Het
Elavl3 G A 9: 21,929,846 (GRCm39) R353C probably damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fbxo3 A G 2: 103,883,757 (GRCm39) D327G possibly damaging Het
Galr1 T C 18: 82,424,256 (GRCm39) N7S probably benign Het
Glyatl3 T C 17: 41,215,802 (GRCm39) T235A probably damaging Het
Gm5145 A C 17: 20,790,967 (GRCm39) Q115P probably benign Het
Grm5 T C 7: 87,780,069 (GRCm39) S1202P probably benign Het
Itsn1 G A 16: 91,615,446 (GRCm39) R397H unknown Het
Jmjd1c A G 10: 67,075,644 (GRCm39) N1837S probably damaging Het
Jph3 A T 8: 122,516,136 (GRCm39) probably null Het
Kcna6 A G 6: 126,715,761 (GRCm39) L376P probably damaging Het
Kcne3 C G 7: 99,833,520 (GRCm39) R46G probably benign Het
Kcnq2 T C 2: 180,722,934 (GRCm39) D842G probably damaging Het
Klhl12 A T 1: 134,386,219 (GRCm39) I4F probably benign Het
Kpna1 T A 16: 35,854,235 (GRCm39) I525N probably benign Het
Krtap31-1 T C 11: 99,798,949 (GRCm39) C51R possibly damaging Het
Ms4a12 C T 19: 11,207,723 (GRCm39) G61D possibly damaging Het
Nol4 T C 18: 22,956,400 (GRCm39) N115D Het
Nudt16l2 A C 9: 105,021,709 (GRCm39) Y112* probably null Het
Pcdh15 A G 10: 74,289,827 (GRCm39) Y882C probably damaging Het
Pde8b T A 13: 95,244,202 (GRCm39) H79L probably benign Het
Pdia2 T C 17: 26,417,207 (GRCm39) E79G probably benign Het
Pgap1 A T 1: 54,590,167 (GRCm39) F90L probably damaging Het
Pik3cd T A 4: 149,741,726 (GRCm39) T407S probably benign Het
Pkd1l2 G T 8: 117,724,827 (GRCm39) F2361L possibly damaging Het
Pla2g12b A T 10: 59,246,816 (GRCm39) R77* probably null Het
Ppfia2 A G 10: 106,655,399 (GRCm39) Y322C probably damaging Het
Psg23 T C 7: 18,341,108 (GRCm39) Q382R possibly damaging Het
Ptprq A G 10: 107,546,484 (GRCm39) V270A probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Robo2 T C 16: 73,695,838 (GRCm39) E1431G probably benign Het
Sdk2 A G 11: 113,764,027 (GRCm39) I253T possibly damaging Het
Sox9 A C 11: 112,675,635 (GRCm39) I275L probably benign Het
Tlr4 A G 4: 66,758,058 (GRCm39) I284V probably benign Het
Unc13b A G 4: 43,171,860 (GRCm39) D896G unknown Het
Usp48 A T 4: 137,371,739 (GRCm39) H955L probably damaging Het
Vps54 T C 11: 21,213,307 (GRCm39) I30T probably benign Het
Zfp106 G A 2: 120,366,096 (GRCm39) R59* probably null Het
Zmym4 A T 4: 126,783,332 (GRCm39) D1169E possibly damaging Het
Zscan2 T A 7: 80,525,448 (GRCm39) Y390N probably damaging Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35,554,096 (GRCm39) nonsense probably null
IGL01336:Ahr APN 12 35,553,839 (GRCm39) missense probably benign 0.19
IGL01972:Ahr APN 12 35,554,448 (GRCm39) missense possibly damaging 0.89
IGL02117:Ahr APN 12 35,562,922 (GRCm39) nonsense probably null
IGL03028:Ahr APN 12 35,554,709 (GRCm39) missense probably benign
IGL03110:Ahr APN 12 35,554,970 (GRCm39) missense probably damaging 0.98
IGL03394:Ahr APN 12 35,553,751 (GRCm39) nonsense probably null
IGL03403:Ahr APN 12 35,554,325 (GRCm39) missense possibly damaging 0.63
BB002:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
BB012:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
R0620:Ahr UTSW 12 35,558,193 (GRCm39) missense probably benign 0.26
R0784:Ahr UTSW 12 35,558,141 (GRCm39) missense possibly damaging 0.79
R1133:Ahr UTSW 12 35,576,805 (GRCm39) missense probably damaging 1.00
R1168:Ahr UTSW 12 35,554,531 (GRCm39) missense possibly damaging 0.49
R4678:Ahr UTSW 12 35,557,463 (GRCm39) missense probably damaging 1.00
R5615:Ahr UTSW 12 35,553,884 (GRCm39) missense probably benign 0.01
R6066:Ahr UTSW 12 35,554,920 (GRCm39) missense probably damaging 0.99
R6466:Ahr UTSW 12 35,554,031 (GRCm39) missense probably benign 0.29
R7369:Ahr UTSW 12 35,554,659 (GRCm39) missense possibly damaging 0.94
R7382:Ahr UTSW 12 35,554,514 (GRCm39) missense probably damaging 1.00
R7685:Ahr UTSW 12 35,554,016 (GRCm39) missense probably damaging 0.96
R7819:Ahr UTSW 12 35,559,999 (GRCm39) missense probably damaging 1.00
R7925:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
R8179:Ahr UTSW 12 35,560,050 (GRCm39) missense probably benign 0.01
R8274:Ahr UTSW 12 35,560,068 (GRCm39) missense probably benign
R8342:Ahr UTSW 12 35,558,271 (GRCm39) missense probably damaging 1.00
R8985:Ahr UTSW 12 35,576,736 (GRCm39) missense possibly damaging 0.91
R9069:Ahr UTSW 12 35,562,771 (GRCm39) intron probably benign
R9114:Ahr UTSW 12 35,561,164 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGAGCAAAGTTCTGTG -3'
(R):5'- GGACGAAATCCTGACCTACGTG -3'

Sequencing Primer
(F):5'- AGCAAAGTTCTGTGTGTAAGGC -3'
(R):5'- TGACCTACGTGCAGGATTCC -3'
Posted On 2019-12-20