Incidental Mutation 'R7897:Kpna1'
ID 609775
Institutional Source Beutler Lab
Gene Symbol Kpna1
Ensembl Gene ENSMUSG00000022905
Gene Name karyopherin (importin) alpha 1
Synonyms m-importin-alpha-S1, Rch2, NPI1, mSRP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock # R7897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 35978750-36037131 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36033865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 525 (I525N)
Ref Sequence ENSEMBL: ENSMUSP00000004054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000172534] [ENSMUST00000173696]
AlphaFold Q60960
Predicted Effect probably benign
Transcript: ENSMUST00000004054
AA Change: I525N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905
AA Change: I525N

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172534
Predicted Effect probably benign
Transcript: ENSMUST00000173696
SMART Domains Protein: ENSMUSP00000134534
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 2 105 9.3e-31 PFAM
Blast:ARM 114 149 1e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. This protein interacts with the recombination activating gene 1 (RAG1) protein and is a putative substrate of the RAG1 ubiquitin ligase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any nervous system or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A C 9: 105,144,510 Y112* probably null Het
Abcb11 TGTTGATCCATA T 2: 69,323,872 probably null Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Abcc10 T C 17: 46,324,073 T335A probably benign Het
Actr3b T C 5: 25,831,659 Y245H probably benign Het
Afm G A 5: 90,547,868 M411I probably benign Het
Ahr T C 12: 35,504,170 N650S possibly damaging Het
Ap5m1 A G 14: 49,073,775 R101G probably benign Het
Armcx5 AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA X: 135,745,704 probably benign Het
Atp13a4 T C 16: 29,396,466 Q1151R Het
Bcl9 A G 3: 97,205,251 V1296A possibly damaging Het
Bsn A C 9: 108,111,866 M2229R probably damaging Het
Cfap74 T C 4: 155,429,894 V529A Het
Clip1 C T 5: 123,622,798 V767M probably benign Het
Col6a5 A G 9: 105,889,183 I1846T possibly damaging Het
Crisp1 A T 17: 40,307,765 D68E probably benign Het
Csmd1 A T 8: 17,534,919 L19Q possibly damaging Het
Cul7 T C 17: 46,658,005 I892T probably benign Het
Elavl3 G A 9: 22,018,550 R353C probably damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fbxo3 A G 2: 104,053,412 D327G possibly damaging Het
Galr1 T C 18: 82,406,131 N7S probably benign Het
Glyatl3 T C 17: 40,904,911 T235A probably damaging Het
Gm11639 A T 11: 104,998,235 Y4159F probably benign Het
Gm5145 A C 17: 20,570,705 Q115P probably benign Het
Grm5 T C 7: 88,130,861 S1202P probably benign Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Jmjd1c A G 10: 67,239,865 N1837S probably damaging Het
Jph3 A T 8: 121,789,397 probably null Het
Kcna6 A G 6: 126,738,798 L376P probably damaging Het
Kcne3 C G 7: 100,184,313 R46G probably benign Het
Kcnq2 T C 2: 181,081,141 D842G probably damaging Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Krtap31-1 T C 11: 99,908,123 C51R possibly damaging Het
Ms4a12 C T 19: 11,230,359 G61D possibly damaging Het
Nol4 T C 18: 22,823,343 N115D Het
Pcdh15 A G 10: 74,453,995 Y882C probably damaging Het
Pde8b T A 13: 95,107,694 H79L probably benign Het
Pdia2 T C 17: 26,198,233 E79G probably benign Het
Pgap1 A T 1: 54,551,008 F90L probably damaging Het
Pik3cd T A 4: 149,657,269 T407S probably benign Het
Pkd1l2 G T 8: 116,998,088 F2361L possibly damaging Het
Pla2g12b A T 10: 59,410,994 R77* probably null Het
Ppfia2 A G 10: 106,819,538 Y322C probably damaging Het
Psg23 T C 7: 18,607,183 Q382R possibly damaging Het
Ptprq A G 10: 107,710,623 V270A probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Robo2 T C 16: 73,898,950 E1431G probably benign Het
Sdk2 A G 11: 113,873,201 I253T possibly damaging Het
Sox9 A C 11: 112,784,809 I275L probably benign Het
Tlr4 A G 4: 66,839,821 I284V probably benign Het
Unc13b A G 4: 43,171,860 D896G unknown Het
Usp48 A T 4: 137,644,428 H955L probably damaging Het
Vps54 T C 11: 21,263,307 I30T probably benign Het
Zfp106 G A 2: 120,535,615 R59* probably null Het
Zmym4 A T 4: 126,889,539 D1169E possibly damaging Het
Zscan2 T A 7: 80,875,700 Y390N probably damaging Het
Other mutations in Kpna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Kpna1 APN 16 36012889 intron probably benign
IGL01653:Kpna1 APN 16 36020192 missense probably benign
IGL02412:Kpna1 APN 16 36031191 missense probably benign 0.06
IGL03102:Kpna1 APN 16 36012919 missense probably damaging 1.00
IGL03340:Kpna1 APN 16 36000246 missense probably damaging 1.00
R0040:Kpna1 UTSW 16 36023241 missense probably damaging 0.97
R0456:Kpna1 UTSW 16 36002900 missense possibly damaging 0.94
R0457:Kpna1 UTSW 16 36002905 missense probably benign 0.03
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1146:Kpna1 UTSW 16 36033379 nonsense probably null
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R1347:Kpna1 UTSW 16 36009326 missense probably benign 0.44
R2225:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2226:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2227:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R2251:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R2252:Kpna1 UTSW 16 36021569 missense possibly damaging 0.93
R2271:Kpna1 UTSW 16 36031221 missense probably damaging 0.99
R3952:Kpna1 UTSW 16 36002882 missense probably benign 0.13
R4771:Kpna1 UTSW 16 36033403 missense probably damaging 1.00
R4954:Kpna1 UTSW 16 36033326 missense probably damaging 1.00
R5075:Kpna1 UTSW 16 36009352 missense probably damaging 1.00
R5824:Kpna1 UTSW 16 36020205 missense possibly damaging 0.91
R5873:Kpna1 UTSW 16 36014228 intron probably benign
R6221:Kpna1 UTSW 16 36020688 missense probably benign 0.02
R6603:Kpna1 UTSW 16 36029520 critical splice acceptor site probably null
R7168:Kpna1 UTSW 16 36015962 intron probably benign
R7447:Kpna1 UTSW 16 36029639 missense probably damaging 1.00
R7872:Kpna1 UTSW 16 36023195 missense probably benign 0.00
R9069:Kpna1 UTSW 16 36016011 intron probably benign
R9124:Kpna1 UTSW 16 36033274 missense probably benign 0.06
R9233:Kpna1 UTSW 16 36033423 missense probably damaging 0.99
R9365:Kpna1 UTSW 16 36012917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGCCAGAAACTGCTTG -3'
(R):5'- GAGCCAGAGGTTTTCCAGATG -3'

Sequencing Primer
(F):5'- CAGAAACTGCTTGCAATGTGC -3'
(R):5'- TTCCAGATGTGTGTAAGAGAGC -3'
Posted On 2019-12-20