Incidental Mutation 'R0681:Cldn6'
ID60980
Institutional Source Beutler Lab
Gene Symbol Cldn6
Ensembl Gene ENSMUSG00000023906
Gene Nameclaudin 6
Synonyms
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0681 (G1)
Quality Score122
Status Validated
Chromosome17
Chromosomal Location23679365-23682446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23681193 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 44 (Q44K)
Ref Sequence ENSEMBL: ENSMUSP00000024699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024698] [ENSMUST00000024699] [ENSMUST00000085989] [ENSMUST00000167059]
Predicted Effect probably benign
Transcript: ENSMUST00000024698
SMART Domains Protein: ENSMUSP00000024698
Gene: ENSMUSG00000023905

DomainStartEndE-ValueType
Pfam:stn_TNFRSF12A 1 129 4.7e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000024699
AA Change: Q44K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024699
Gene: ENSMUSG00000023906
AA Change: Q44K

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 2.5e-35 PFAM
Pfam:Claudin_2 15 183 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085989
SMART Domains Protein: ENSMUSP00000093236
Gene: ENSMUSG00000066720

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 9.7e-35 PFAM
Pfam:Claudin_2 15 183 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167059
SMART Domains Protein: ENSMUSP00000131574
Gene: ENSMUSG00000023905

DomainStartEndE-ValueType
Pfam:stn_TNFRSF12A 1 35 2.9e-13 PFAM
Pfam:stn_TNFRSF12A 32 94 1.1e-33 PFAM
Meta Mutation Damage Score 0.5003 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is essential for blastocyst formation in preimplantation mouse embryos, and is invloved in and is crucial for the formation and maintenance of the epidermal permeability barrier. This gene is adjacent to another family member Cldn9 on chromosome 17. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele do not exhibit overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Cyp1b1 A G 17: 79,713,846 S156P probably damaging Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Cldn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cldn6 APN 17 23681724 unclassified probably benign
IGL01876:Cldn6 APN 17 23681184 missense probably damaging 0.98
IGL02529:Cldn6 APN 17 23681317 missense probably damaging 0.98
R0853:Cldn6 UTSW 17 23681464 missense probably damaging 0.99
R4133:Cldn6 UTSW 17 23681493 missense probably damaging 1.00
R4366:Cldn6 UTSW 17 23681520 missense probably benign 0.00
R4454:Cldn6 UTSW 17 23681086 unclassified probably null
R4780:Cldn6 UTSW 17 23681247 missense probably benign 0.30
R7775:Cldn6 UTSW 17 23681607 missense probably damaging 1.00
R7778:Cldn6 UTSW 17 23681607 missense probably damaging 1.00
R7824:Cldn6 UTSW 17 23681607 missense probably damaging 1.00
R7863:Cldn6 UTSW 17 23681122 missense probably benign 0.00
R7946:Cldn6 UTSW 17 23681122 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGACATAGCAGCCAACTGTCAAG -3'
(R):5'- TGATGCCAGAGATGAGCACCAGAC -3'

Sequencing Primer
(F):5'- GATGTCCAGACATGCTGCTC -3'
(R):5'- ATCTTCCACACAGGTAGTGC -3'
Posted On2013-07-30