Incidental Mutation 'R7898:Lgalsl2'
ID 609817
Institutional Source Beutler Lab
Gene Symbol Lgalsl2
Ensembl Gene ENSMUSG00000048398
Gene Name galectin like 2
Synonyms Gm5065
MMRRC Submission 045950-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7898 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5353541-5363681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 5362441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 24 (R24H)
Ref Sequence ENSEMBL: ENSMUSP00000055799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056639] [ENSMUST00000207531]
AlphaFold Q7TPX9
Predicted Effect probably benign
Transcript: ENSMUST00000056639
AA Change: R24H

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055799
Gene: ENSMUSG00000048398
AA Change: R24H

DomainStartEndE-ValueType
GLECT 31 165 1.56e-15 SMART
Gal-bind_lectin 37 165 2.51e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207531
AA Change: R24H

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,255,275 (GRCm39) probably null Het
Afg2a T G 3: 37,474,620 (GRCm39) M44R probably benign Het
Ankef1 C A 2: 136,395,618 (GRCm39) N649K probably benign Het
Arl5b T A 2: 15,079,869 (GRCm39) S147T probably damaging Het
Arnt2 A T 7: 83,918,155 (GRCm39) probably null Het
Ash1l A G 3: 88,890,932 (GRCm39) E937G possibly damaging Het
Asxl1 T G 2: 153,241,854 (GRCm39) S802R possibly damaging Het
Cacna1h T A 17: 25,611,250 (GRCm39) H516L probably damaging Het
Cad A G 5: 31,218,829 (GRCm39) Y550C probably damaging Het
Cdo1 A G 18: 46,861,157 (GRCm39) I18T probably benign Het
Cfap251 A T 5: 123,460,517 (GRCm39) I1160F probably damaging Het
Chd2 A G 7: 73,169,223 (GRCm39) probably null Het
Dbf4 A G 5: 8,458,232 (GRCm39) probably null Het
Dcdc2a A T 13: 25,286,361 (GRCm39) R132W possibly damaging Het
Dnah10 T C 5: 124,859,425 (GRCm39) S2131P probably damaging Het
Eef2k A G 7: 120,494,441 (GRCm39) Y599C probably damaging Het
Eno2 C T 6: 124,744,225 (GRCm39) probably null Het
Fam124b T A 1: 80,191,512 (GRCm39) probably benign Het
Fezf2 A G 14: 12,342,701 (GRCm38) I388T possibly damaging Het
Gbp11 T C 5: 105,472,798 (GRCm39) N542S probably benign Het
Gdpd1 T A 11: 86,932,639 (GRCm39) I229F probably damaging Het
Gria1 T A 11: 57,133,591 (GRCm39) V490E probably damaging Het
Grm8 G A 6: 27,762,422 (GRCm39) R268C probably damaging Het
Hectd4 T A 5: 121,469,880 (GRCm39) S2592T probably benign Het
Herpud1 C T 8: 95,118,828 (GRCm39) T194I probably benign Het
Hspa1b T C 17: 35,177,167 (GRCm39) T273A probably benign Het
Iftap T A 2: 101,416,747 (GRCm39) K67N probably benign Het
Ighm T A 12: 113,384,873 (GRCm39) K327* probably null Het
Igkv3-4 A T 6: 70,649,297 (GRCm39) I99F probably damaging Het
Iqca1l T C 5: 24,758,643 (GRCm39) E117G probably damaging Het
Isl2 C A 9: 55,449,723 (GRCm39) S97R probably benign Het
Klhl12 A T 1: 134,386,219 (GRCm39) I4F probably benign Het
Lrp2 T C 2: 69,271,710 (GRCm39) E4074G probably benign Het
Mcm3ap A G 10: 76,342,441 (GRCm39) N1645D probably damaging Het
Mettl23 T C 11: 116,736,679 (GRCm39) probably benign Het
Mettl24 A G 10: 40,686,478 (GRCm39) E285G probably benign Het
Mis18bp1 A G 12: 65,196,246 (GRCm39) L506P probably benign Het
Mup18 G T 4: 61,590,925 (GRCm39) probably null Het
Myom1 T C 17: 71,352,747 (GRCm39) L357P probably benign Het
Nkx2-9 G A 12: 56,659,031 (GRCm39) A61V probably benign Het
Or52n5 C T 7: 104,588,573 (GRCm39) A280V probably damaging Het
Pbx1 A T 1: 168,012,616 (GRCm39) M340K probably benign Het
Pcdhb17 A T 18: 37,618,233 (GRCm39) N8Y probably benign Het
Pex13 C A 11: 23,600,929 (GRCm39) probably null Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plxnb1 A G 9: 108,943,408 (GRCm39) R1884G probably damaging Het
Polq T A 16: 36,865,245 (GRCm39) V699E probably damaging Het
Ppl C T 16: 4,906,725 (GRCm39) R1190H probably damaging Het
Prr14l A T 5: 32,987,310 (GRCm39) H728Q probably benign Het
Prss12 T C 3: 123,300,145 (GRCm39) V752A possibly damaging Het
Prss56 A G 1: 87,111,921 (GRCm39) S51G probably benign Het
Pwp2 G A 10: 78,009,240 (GRCm39) R854W probably damaging Het
Rhobtb2 C T 14: 70,033,746 (GRCm39) C493Y probably damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rusf1 C A 7: 127,897,177 (GRCm39) A27S probably benign Het
Scap A G 9: 110,213,811 (GRCm39) N1258S possibly damaging Het
Sec31a C T 5: 100,547,336 (GRCm39) G218R probably damaging Het
Siglec15 A T 18: 78,086,914 (GRCm39) M315K probably benign Het
Slc17a6 G A 7: 51,308,573 (GRCm39) probably null Het
Smchd1 T C 17: 71,684,813 (GRCm39) probably null Het
Spag4 A T 2: 155,911,244 (GRCm39) D393V probably damaging Het
Sulf1 A G 1: 12,875,518 (GRCm39) N176S probably damaging Het
Tmem9 T A 1: 135,955,125 (GRCm39) probably null Het
Tnpo3 T C 6: 29,565,223 (GRCm39) I577V probably benign Het
Tti1 A C 2: 157,835,390 (GRCm39) I956S probably benign Het
Wdr81 T C 11: 75,344,725 (GRCm39) R181G probably benign Het
Zfp462 T A 4: 55,012,995 (GRCm39) C1654S probably damaging Het
Zfp74 A T 7: 29,635,380 (GRCm39) C109* probably null Het
Znrf4 A G 17: 56,818,681 (GRCm39) C209R probably damaging Het
Zzef1 T G 11: 72,687,373 (GRCm39) L84R probably damaging Het
Other mutations in Lgalsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02060:Lgalsl2 APN 7 5,362,563 (GRCm39) missense probably damaging 0.99
IGL02147:Lgalsl2 APN 7 5,362,732 (GRCm39) missense probably damaging 1.00
R0771:Lgalsl2 UTSW 7 5,362,822 (GRCm39) missense probably damaging 1.00
R0906:Lgalsl2 UTSW 7 5,362,828 (GRCm39) missense probably damaging 0.99
R2018:Lgalsl2 UTSW 7 5,362,573 (GRCm39) missense probably benign 0.18
R2258:Lgalsl2 UTSW 7 5,362,401 (GRCm39) missense probably benign
R2519:Lgalsl2 UTSW 7 5,362,833 (GRCm39) missense probably damaging 1.00
R2865:Lgalsl2 UTSW 7 5,362,668 (GRCm39) missense probably benign 0.25
R5893:Lgalsl2 UTSW 7 5,362,623 (GRCm39) missense probably benign 0.00
R7485:Lgalsl2 UTSW 7 5,362,440 (GRCm39) missense probably benign 0.39
R7716:Lgalsl2 UTSW 7 5,362,819 (GRCm39) missense possibly damaging 0.56
R7836:Lgalsl2 UTSW 7 5,362,507 (GRCm39) missense probably damaging 1.00
R8192:Lgalsl2 UTSW 7 5,362,595 (GRCm39) missense possibly damaging 0.77
R9324:Lgalsl2 UTSW 7 5,362,527 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CATAAAAGGTCCTTTGGTGGGG -3'
(R):5'- GAGTTCAATCGCCACATCGG -3'

Sequencing Primer
(F):5'- TCATGGGAAAGAGGCTTACGTG -3'
(R):5'- ACATCGGCAGGAGGATCTTC -3'
Posted On 2019-12-20