Incidental Mutation 'R7898:BC017158'
ID609822
Institutional Source Beutler Lab
Gene Symbol BC017158
Ensembl Gene ENSMUSG00000030780
Gene NamecDNA sequence BC017158
SynonymsMGC:28903
Accession Numbers

Genbank: NM_145590; MGI: 2384572

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7898 (G1)
Quality Score191.009
Status Validated
Chromosome7
Chromosomal Location128271379-128298170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128298005 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 27 (A27S)
Ref Sequence ENSEMBL: ENSMUSP00000033044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000126263]
Predicted Effect probably benign
Transcript: ENSMUST00000033044
AA Change: A27S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780
AA Change: A27S

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126263
AA Change: A27S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780
AA Change: A27S

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative transmembrane protein containing a conserved DUF647 domain that may be involved in protein-protein interaction. The encoded protein is related to a plant protein that participates in ultraviolet B light-sensing during root morphogenesis. [provided by RefSeq, Feb 2013]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4931409K22Rik T C 5: 24,553,645 E117G probably damaging Het
Acaca T C 11: 84,364,449 probably null Het
Ankef1 C A 2: 136,553,698 N649K probably benign Het
Arl5b T A 2: 15,075,058 S147T probably damaging Het
Arnt2 A T 7: 84,268,947 probably null Het
Ash1l A G 3: 88,983,625 E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 K67N probably benign Het
Cacna1h T A 17: 25,392,276 H516L probably damaging Het
Cad A G 5: 31,061,485 Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 I18T probably benign Het
Chd2 A G 7: 73,519,475 probably null Het
Dbf4 A G 5: 8,408,232 probably null Het
Dcdc2a A T 13: 25,102,378 R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 S2131P probably damaging Het
Eef2k A G 7: 120,895,218 Y599C probably damaging Het
Eno2 C T 6: 124,767,262 probably null Het
Fam124b T A 1: 80,213,795 probably benign Het
Fezf2 A G 14: 12,342,701 I388T possibly damaging Het
Gbp11 T C 5: 105,324,932 N542S probably benign Het
Gdpd1 T A 11: 87,041,813 I229F probably damaging Het
Gm5065 G A 7: 5,359,442 R24H probably benign Het
Gria1 T A 11: 57,242,765 V490E probably damaging Het
Grm8 G A 6: 27,762,423 R268C probably damaging Het
Hectd4 T A 5: 121,331,817 S2592T probably benign Het
Herpud1 C T 8: 94,392,200 T194I probably benign Het
Hspa1b T C 17: 34,958,191 T273A probably benign Het
Ighm T A 12: 113,421,253 K327* probably null Het
Igkv3-4 A T 6: 70,672,313 I99F probably damaging Het
Isl2 C A 9: 55,542,439 S97R probably benign Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Lrp2 T C 2: 69,441,366 E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Mettl23 T C 11: 116,845,853 probably benign Het
Mettl24 A G 10: 40,810,482 E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 L506P probably benign Het
Mup18 G T 4: 61,672,688 probably null Het
Myom1 T C 17: 71,045,752 L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 A61V probably benign Het
Olfr669 C T 7: 104,939,366 A280V probably damaging Het
Pbx1 A T 1: 168,185,047 M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 N8Y probably benign Het
Pex13 C A 11: 23,650,929 probably null Het
Plxnb1 A G 9: 109,114,340 R1884G probably damaging Het
Polq T A 16: 37,044,883 V699E probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prr14l A T 5: 32,829,966 H728Q probably benign Het
Prss12 T C 3: 123,506,496 V752A possibly damaging Het
Prss56 A G 1: 87,184,199 S51G probably benign Het
Pwp2 G A 10: 78,173,406 R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 C493Y probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scap A G 9: 110,384,743 N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 G218R probably damaging Het
Siglec15 A T 18: 78,043,699 M315K probably benign Het
Slc17a6 G A 7: 51,658,825 probably null Het
Smchd1 T C 17: 71,377,818 probably null Het
Spag4 A T 2: 156,069,324 D393V probably damaging Het
Spata5 T G 3: 37,420,471 M44R probably benign Het
Sulf1 A G 1: 12,805,294 N176S probably damaging Het
Tmem9 T A 1: 136,027,387 probably null Het
Tnpo3 T C 6: 29,565,224 I577V probably benign Het
Tti1 A C 2: 157,993,470 I956S probably benign Het
Wdr66 A T 5: 123,322,454 I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 R181G probably benign Het
Zfp462 T A 4: 55,012,995 C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 C109* probably null Het
Znrf4 A G 17: 56,511,681 C209R probably damaging Het
Zzef1 T G 11: 72,796,547 L84R probably damaging Het
Other mutations in BC017158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:BC017158 APN 7 128276410 missense probably damaging 1.00
IGL02527:BC017158 APN 7 128276231 missense possibly damaging 0.92
IGL02572:BC017158 APN 7 128290580 splice site probably benign
3-1:BC017158 UTSW 7 128276129 missense possibly damaging 0.87
PIT4445001:BC017158 UTSW 7 128276534 missense probably benign 0.15
R0364:BC017158 UTSW 7 128290614 missense probably damaging 1.00
R0590:BC017158 UTSW 7 128297470 missense probably damaging 1.00
R0616:BC017158 UTSW 7 128272631 intron probably null
R2060:BC017158 UTSW 7 128288331 missense probably damaging 1.00
R3849:BC017158 UTSW 7 128285208 missense probably damaging 1.00
R4487:BC017158 UTSW 7 128288358 missense probably damaging 1.00
R4510:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4511:BC017158 UTSW 7 128276140 missense probably damaging 0.99
R4708:BC017158 UTSW 7 128274680 missense probably benign 0.00
R4793:BC017158 UTSW 7 128288202 intron probably benign
R4983:BC017158 UTSW 7 128276473 unclassified probably benign
R5502:BC017158 UTSW 7 128285136 missense probably damaging 1.00
R6181:BC017158 UTSW 7 128297460 critical splice donor site probably null
R6312:BC017158 UTSW 7 128273543 missense probably benign 0.02
R7981:BC017158 UTSW 7 128298005 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGTATGGCAGGTAATCCGG -3'
(R):5'- GACACACAATAATCGGAGTTCCAAG -3'

Sequencing Primer
(F):5'- TAATCCGGGCTGACGCTATCTG -3'
(R):5'- TAATCGGAGTTCCAAGAGAATAAAAG -3'
Posted On2019-12-20