Incidental Mutation 'R0681:Cyp1b1'
ID60983
Institutional Source Beutler Lab
Gene Symbol Cyp1b1
Ensembl Gene ENSMUSG00000024087
Gene Namecytochrome P450, family 1, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 038866-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R0681 (G1)
Quality Score142
Status Validated
Chromosome17
Chromosomal Location79706953-79715041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79713846 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000024894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024894]
Predicted Effect probably damaging
Transcript: ENSMUST00000024894
AA Change: S156P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024894
Gene: ENSMUSG00000024087
AA Change: S156P

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:p450 51 520 1.3e-100 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The enzyme encoded by this gene localizes to the endoplasmic reticulum and metabolizes procarcinogens such as polycyclic aromatic hydrocarbons and 17beta-estradiol. Mutations in this gene have been associated with primary congenital glaucoma; therefore it is thought that the enzyme also metabolizes a signaling molecule involved in eye development, possibly a steroid. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from the acute bone marrow cytotoxic and preleukemic effects of DMBA, show a decreased incidence of DMBA-induced lymphomas, and display background-sensitive ocular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,934,650 probably benign Het
Adgrv1 C A 13: 81,528,530 D1341Y probably damaging Het
Ahdc1 T C 4: 133,065,516 F1356S possibly damaging Het
BC027072 T G 17: 71,749,514 H1056P probably benign Het
Cdk13 A G 13: 17,721,297 probably benign Het
Cfhr1 A T 1: 139,557,511 S66T probably damaging Het
Cldn6 C A 17: 23,681,193 Q44K probably damaging Het
Cntnap5c T C 17: 58,305,555 V863A possibly damaging Het
Col6a4 T A 9: 106,067,144 K1044* probably null Het
Cyb561d1 A G 3: 108,199,267 V212A probably benign Het
Dock7 G A 4: 99,016,704 H645Y probably damaging Het
Dpp3 T C 19: 4,914,654 N542D probably damaging Het
Fastkd3 C T 13: 68,591,928 probably benign Het
Galnt10 T A 11: 57,769,540 V268D probably damaging Het
Gm13078 A T 4: 143,728,052 T307S probably benign Het
Grb14 G T 2: 64,917,287 A10E probably damaging Het
Grin2c A G 11: 115,249,653 V1213A probably benign Het
Grip1 C T 10: 120,010,230 T570I probably damaging Het
Hif1an T C 19: 44,563,323 Y71H probably benign Het
Hsd17b11 T A 5: 104,003,206 I221L probably benign Het
Htra1 A T 7: 130,979,297 probably benign Het
Igfn1 T C 1: 135,963,853 E2308G possibly damaging Het
Mapk9 T A 11: 49,869,245 S129T probably damaging Het
Med22 T C 2: 26,910,379 T13A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mtus1 A T 8: 40,993,517 L489Q probably damaging Het
Naprt G A 15: 75,893,632 P120S probably damaging Het
Nwd1 C T 8: 72,662,337 P172L probably damaging Het
Ogfod2 A G 5: 124,112,844 E62G probably null Het
Olfr1445 T C 19: 12,884,079 L66P probably damaging Het
Olfr1445 A G 19: 12,884,546 T222A probably damaging Het
Olfr211 A T 6: 116,494,400 S264C probably damaging Het
Palm A C 10: 79,819,493 T362P probably benign Het
Pcdh8 T C 14: 79,769,960 T388A probably benign Het
Pclo A G 5: 14,675,318 I1397V unknown Het
Per1 A G 11: 69,101,201 E127G probably damaging Het
Plekha1 T C 7: 130,900,623 V30A possibly damaging Het
Rab26 A G 17: 24,527,966 probably benign Het
Rasal2 T C 1: 157,157,180 D999G possibly damaging Het
Rfx5 C T 3: 94,956,355 T105I probably damaging Het
Rrp1b T C 17: 32,060,395 S677P probably damaging Het
Scaf4 G A 16: 90,249,694 P485S unknown Het
Scn5a A T 9: 119,539,640 M273K probably damaging Het
Sec22a C T 16: 35,361,556 probably null Het
Slc10a6 C A 5: 103,612,449 V227F possibly damaging Het
Slc39a3 C G 10: 81,033,731 E31Q probably benign Het
Spsb1 C T 4: 149,906,917 V65I probably benign Het
Tdrd7 T A 4: 46,016,879 M673K probably benign Het
Trim8 C A 19: 46,515,093 S361R possibly damaging Het
Ucp1 T A 8: 83,295,307 M256K possibly damaging Het
Vmn1r46 A T 6: 89,976,964 D265V probably damaging Het
Zbtb5 T C 4: 44,993,787 I532M probably damaging Het
Other mutations in Cyp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0387:Cyp1b1 UTSW 17 79713774 missense probably benign
R0400:Cyp1b1 UTSW 17 79713587 missense probably damaging 1.00
R0456:Cyp1b1 UTSW 17 79710275 missense probably benign 0.02
R2851:Cyp1b1 UTSW 17 79710220 missense probably benign 0.00
R2897:Cyp1b1 UTSW 17 79713731 missense probably benign 0.00
R4706:Cyp1b1 UTSW 17 79713342 missense possibly damaging 0.86
R5070:Cyp1b1 UTSW 17 79710611 missense probably benign
R6104:Cyp1b1 UTSW 17 79710205 missense probably damaging 1.00
R6195:Cyp1b1 UTSW 17 79714266 missense probably damaging 1.00
R6233:Cyp1b1 UTSW 17 79714266 missense probably damaging 1.00
R7440:Cyp1b1 UTSW 17 79713557 missense probably damaging 0.99
R7770:Cyp1b1 UTSW 17 79713299 missense probably damaging 1.00
R7894:Cyp1b1 UTSW 17 79714215 missense possibly damaging 0.81
R7977:Cyp1b1 UTSW 17 79714215 missense possibly damaging 0.81
X0067:Cyp1b1 UTSW 17 79710691 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGAACGAAGTTGCTGAAGTTGC -3'
(R):5'- AATGGAGAGAGTGCCATCCACCAG -3'

Sequencing Primer
(F):5'- CTGAGCAGCTCTAGGAACTC -3'
(R):5'- GGCGTTCGGTCACTACTCT -3'
Posted On2013-07-30