Incidental Mutation 'R7898:Acaca'
ID609834
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7898 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 84364449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
Predicted Effect probably null
Transcript: ENSMUST00000020843
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103201
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4931409K22Rik T C 5: 24,553,645 E117G probably damaging Het
Ankef1 C A 2: 136,553,698 N649K probably benign Het
Arl5b T A 2: 15,075,058 S147T probably damaging Het
Arnt2 A T 7: 84,268,947 probably null Het
Ash1l A G 3: 88,983,625 E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 K67N probably benign Het
BC017158 C A 7: 128,298,005 A27S probably benign Het
Cacna1h T A 17: 25,392,276 H516L probably damaging Het
Cad A G 5: 31,061,485 Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 I18T probably benign Het
Chd2 A G 7: 73,519,475 probably null Het
Dbf4 A G 5: 8,408,232 probably null Het
Dcdc2a A T 13: 25,102,378 R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 S2131P probably damaging Het
Eef2k A G 7: 120,895,218 Y599C probably damaging Het
Eno2 C T 6: 124,767,262 probably null Het
Fam124b T A 1: 80,213,795 probably benign Het
Fezf2 A G 14: 12,342,701 I388T possibly damaging Het
Gbp11 T C 5: 105,324,932 N542S probably benign Het
Gdpd1 T A 11: 87,041,813 I229F probably damaging Het
Gm5065 G A 7: 5,359,442 R24H probably benign Het
Gria1 T A 11: 57,242,765 V490E probably damaging Het
Grm8 G A 6: 27,762,423 R268C probably damaging Het
Hectd4 T A 5: 121,331,817 S2592T probably benign Het
Herpud1 C T 8: 94,392,200 T194I probably benign Het
Hspa1b T C 17: 34,958,191 T273A probably benign Het
Ighm T A 12: 113,421,253 K327* probably null Het
Igkv3-4 A T 6: 70,672,313 I99F probably damaging Het
Isl2 C A 9: 55,542,439 S97R probably benign Het
Klhl12 A T 1: 134,458,481 I4F probably benign Het
Lrp2 T C 2: 69,441,366 E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 N1645D probably damaging Het
Mettl23 T C 11: 116,845,853 probably benign Het
Mettl24 A G 10: 40,810,482 E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 L506P probably benign Het
Mup18 G T 4: 61,672,688 probably null Het
Myom1 T C 17: 71,045,752 L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 A61V probably benign Het
Olfr669 C T 7: 104,939,366 A280V probably damaging Het
Pbx1 A T 1: 168,185,047 M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 N8Y probably benign Het
Pex13 C A 11: 23,650,929 probably null Het
Plxnb1 A G 9: 109,114,340 R1884G probably damaging Het
Polq T A 16: 37,044,883 V699E probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prr14l A T 5: 32,829,966 H728Q probably benign Het
Prss12 T C 3: 123,506,496 V752A possibly damaging Het
Prss56 A G 1: 87,184,199 S51G probably benign Het
Pwp2 G A 10: 78,173,406 R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 C493Y probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scap A G 9: 110,384,743 N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 G218R probably damaging Het
Siglec15 A T 18: 78,043,699 M315K probably benign Het
Slc17a6 G A 7: 51,658,825 probably null Het
Smchd1 T C 17: 71,377,818 probably null Het
Spag4 A T 2: 156,069,324 D393V probably damaging Het
Spata5 T G 3: 37,420,471 M44R probably benign Het
Sulf1 A G 1: 12,805,294 N176S probably damaging Het
Tmem9 T A 1: 136,027,387 probably null Het
Tnpo3 T C 6: 29,565,224 I577V probably benign Het
Tti1 A C 2: 157,993,470 I956S probably benign Het
Wdr66 A T 5: 123,322,454 I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 R181G probably benign Het
Zfp462 T A 4: 55,012,995 C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 C109* probably null Het
Znrf4 A G 17: 56,511,681 C209R probably damaging Het
Zzef1 T G 11: 72,796,547 L84R probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
greenhouse UTSW 11 84338356 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7950:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7981:Acaca UTSW 11 84364449 critical splice donor site probably null
R7990:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATTCTGAAAGCGGGCC -3'
(R):5'- AAGCAAGTGGTCGATAAAGCTTAC -3'

Sequencing Primer
(F):5'- AGTTGAGGTCTGAGCCTGACATC -3'
(R):5'- GTGGTCGATAAAGCTTACTTTTCTC -3'
Posted On2019-12-20