Incidental Mutation 'R7898:Polq'
ID 609844
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 045950-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.382) question?
Stock # R7898 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 37011786-37095417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37044883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 699 (V699E)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect probably damaging
Transcript: ENSMUST00000054034
AA Change: V699E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: V699E

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071452
AA Change: V420E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: V420E

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 (GRCm38) probably benign Het
4931409K22Rik T C 5: 24,553,645 (GRCm38) E117G probably damaging Het
Acaca T C 11: 84,364,449 (GRCm38) probably null Het
Ankef1 C A 2: 136,553,698 (GRCm38) N649K probably benign Het
Arl5b T A 2: 15,075,058 (GRCm38) S147T probably damaging Het
Arnt2 A T 7: 84,268,947 (GRCm38) probably null Het
Ash1l A G 3: 88,983,625 (GRCm38) E937G possibly damaging Het
Asxl1 T G 2: 153,399,934 (GRCm38) S802R possibly damaging Het
B230118H07Rik T A 2: 101,586,402 (GRCm38) K67N probably benign Het
BC017158 C A 7: 128,298,005 (GRCm38) A27S probably benign Het
Cacna1h T A 17: 25,392,276 (GRCm38) H516L probably damaging Het
Cad A G 5: 31,061,485 (GRCm38) Y550C probably damaging Het
Cdo1 A G 18: 46,728,090 (GRCm38) I18T probably benign Het
Chd2 A G 7: 73,519,475 (GRCm38) probably null Het
Dbf4 A G 5: 8,408,232 (GRCm38) probably null Het
Dcdc2a A T 13: 25,102,378 (GRCm38) R132W possibly damaging Het
Dnah10 T C 5: 124,782,361 (GRCm38) S2131P probably damaging Het
Eef2k A G 7: 120,895,218 (GRCm38) Y599C probably damaging Het
Eno2 C T 6: 124,767,262 (GRCm38) probably null Het
Fam124b T A 1: 80,213,795 (GRCm38) probably benign Het
Fezf2 A G 14: 12,342,701 (GRCm38) I388T possibly damaging Het
Gbp11 T C 5: 105,324,932 (GRCm38) N542S probably benign Het
Gdpd1 T A 11: 87,041,813 (GRCm38) I229F probably damaging Het
Gm5065 G A 7: 5,359,442 (GRCm38) R24H probably benign Het
Gria1 T A 11: 57,242,765 (GRCm38) V490E probably damaging Het
Grm8 G A 6: 27,762,423 (GRCm38) R268C probably damaging Het
Hectd4 T A 5: 121,331,817 (GRCm38) S2592T probably benign Het
Herpud1 C T 8: 94,392,200 (GRCm38) T194I probably benign Het
Hspa1b T C 17: 34,958,191 (GRCm38) T273A probably benign Het
Ighm T A 12: 113,421,253 (GRCm38) K327* probably null Het
Igkv3-4 A T 6: 70,672,313 (GRCm38) I99F probably damaging Het
Isl2 C A 9: 55,542,439 (GRCm38) S97R probably benign Het
Klhl12 A T 1: 134,458,481 (GRCm38) I4F probably benign Het
Lrp2 T C 2: 69,441,366 (GRCm38) E4074G probably benign Het
Mcm3ap A G 10: 76,506,607 (GRCm38) N1645D probably damaging Het
Mettl23 T C 11: 116,845,853 (GRCm38) probably benign Het
Mettl24 A G 10: 40,810,482 (GRCm38) E285G probably benign Het
Mis18bp1 A G 12: 65,149,472 (GRCm38) L506P probably benign Het
Mup18 G T 4: 61,672,688 (GRCm38) probably null Het
Myom1 T C 17: 71,045,752 (GRCm38) L357P probably benign Het
Nkx2-9 G A 12: 56,612,246 (GRCm38) A61V probably benign Het
Olfr669 C T 7: 104,939,366 (GRCm38) A280V probably damaging Het
Pbx1 A T 1: 168,185,047 (GRCm38) M340K probably benign Het
Pcdhb17 A T 18: 37,485,180 (GRCm38) N8Y probably benign Het
Pex13 C A 11: 23,650,929 (GRCm38) probably null Het
Plxnb1 A G 9: 109,114,340 (GRCm38) R1884G probably damaging Het
Ppl C T 16: 5,088,861 (GRCm38) R1190H probably damaging Het
Prr14l A T 5: 32,829,966 (GRCm38) H728Q probably benign Het
Prss12 T C 3: 123,506,496 (GRCm38) V752A possibly damaging Het
Prss56 A G 1: 87,184,199 (GRCm38) S51G probably benign Het
Pwp2 G A 10: 78,173,406 (GRCm38) R854W probably damaging Het
Rhobtb2 C T 14: 69,796,297 (GRCm38) C493Y probably damaging Het
Rictor C T 15: 6,772,154 (GRCm38) S441L probably benign Het
Scap A G 9: 110,384,743 (GRCm38) N1258S possibly damaging Het
Sec31a C T 5: 100,399,477 (GRCm38) G218R probably damaging Het
Siglec15 A T 18: 78,043,699 (GRCm38) M315K probably benign Het
Slc17a6 G A 7: 51,658,825 (GRCm38) probably null Het
Smchd1 T C 17: 71,377,818 (GRCm38) probably null Het
Spag4 A T 2: 156,069,324 (GRCm38) D393V probably damaging Het
Spata5 T G 3: 37,420,471 (GRCm38) M44R probably benign Het
Sulf1 A G 1: 12,805,294 (GRCm38) N176S probably damaging Het
Tmem9 T A 1: 136,027,387 (GRCm38) probably null Het
Tnpo3 T C 6: 29,565,224 (GRCm38) I577V probably benign Het
Tti1 A C 2: 157,993,470 (GRCm38) I956S probably benign Het
Wdr66 A T 5: 123,322,454 (GRCm38) I1160F probably damaging Het
Wdr81 T C 11: 75,453,899 (GRCm38) R181G probably benign Het
Zfp462 T A 4: 55,012,995 (GRCm38) C1654S probably damaging Het
Zfp74 A T 7: 29,935,955 (GRCm38) C109* probably null Het
Znrf4 A G 17: 56,511,681 (GRCm38) C209R probably damaging Het
Zzef1 T G 11: 72,796,547 (GRCm38) L84R probably damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37,065,247 (GRCm38) splice site probably benign
IGL00539:Polq APN 16 37,060,569 (GRCm38) missense probably damaging 0.98
IGL00960:Polq APN 16 37,060,512 (GRCm38) missense probably damaging 0.96
IGL01100:Polq APN 16 37,061,112 (GRCm38) missense probably benign
IGL01112:Polq APN 16 37,017,309 (GRCm38) missense probably damaging 1.00
IGL01138:Polq APN 16 37,045,869 (GRCm38) missense possibly damaging 0.94
IGL01432:Polq APN 16 37,071,822 (GRCm38) splice site probably benign
IGL01522:Polq APN 16 37,027,903 (GRCm38) missense probably damaging 1.00
IGL01565:Polq APN 16 37,013,113 (GRCm38) missense probably benign 0.00
IGL01592:Polq APN 16 37,034,850 (GRCm38) missense probably benign 0.01
IGL01690:Polq APN 16 37,062,838 (GRCm38) missense probably damaging 0.97
IGL01943:Polq APN 16 37,061,443 (GRCm38) missense possibly damaging 0.47
IGL02531:Polq APN 16 37,062,374 (GRCm38) missense possibly damaging 0.75
IGL02553:Polq APN 16 37,041,768 (GRCm38) missense probably damaging 1.00
IGL02623:Polq APN 16 37,060,375 (GRCm38) missense probably benign 0.04
IGL02692:Polq APN 16 37,060,627 (GRCm38) missense probably damaging 1.00
IGL02717:Polq APN 16 37,022,740 (GRCm38) missense probably damaging 1.00
IGL02937:Polq APN 16 37,013,109 (GRCm38) missense probably benign 0.14
IGL02959:Polq APN 16 37,086,566 (GRCm38) missense probably damaging 1.00
IGL03086:Polq APN 16 37,091,049 (GRCm38) missense probably benign 0.02
IGL03141:Polq APN 16 37,017,358 (GRCm38) splice site probably benign
IGL03302:Polq APN 16 37,071,772 (GRCm38) missense probably damaging 1.00
IGL03393:Polq APN 16 37,044,794 (GRCm38) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 37,061,839 (GRCm38) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 37,013,181 (GRCm38) missense probably damaging 1.00
R4280_polq_867 UTSW 16 37,082,057 (GRCm38) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 37,061,819 (GRCm38) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37,060,587 (GRCm38) missense probably benign 0.00
R0013:Polq UTSW 16 37,061,839 (GRCm38) missense possibly damaging 0.56
R0082:Polq UTSW 16 37,017,257 (GRCm38) missense probably benign 0.01
R0212:Polq UTSW 16 37,066,854 (GRCm38) missense probably damaging 0.99
R0387:Polq UTSW 16 37,089,317 (GRCm38) missense probably damaging 1.00
R0387:Polq UTSW 16 37,029,430 (GRCm38) missense probably damaging 1.00
R0427:Polq UTSW 16 37,061,993 (GRCm38) nonsense probably null
R0454:Polq UTSW 16 37,034,890 (GRCm38) missense probably damaging 0.98
R0513:Polq UTSW 16 37,094,502 (GRCm38) missense probably damaging 1.00
R0622:Polq UTSW 16 37,060,993 (GRCm38) missense probably benign 0.02
R0848:Polq UTSW 16 37,062,130 (GRCm38) missense probably benign 0.08
R1142:Polq UTSW 16 37,013,217 (GRCm38) missense probably damaging 0.98
R1218:Polq UTSW 16 37,029,446 (GRCm38) missense possibly damaging 0.93
R1331:Polq UTSW 16 37,041,747 (GRCm38) missense probably damaging 1.00
R1398:Polq UTSW 16 37,062,495 (GRCm38) missense possibly damaging 0.87
R1424:Polq UTSW 16 37,086,528 (GRCm38) missense probably damaging 1.00
R1644:Polq UTSW 16 37,060,264 (GRCm38) missense probably damaging 0.96
R1777:Polq UTSW 16 37,060,224 (GRCm38) missense possibly damaging 0.94
R1820:Polq UTSW 16 37,029,418 (GRCm38) missense possibly damaging 0.48
R1854:Polq UTSW 16 37,062,109 (GRCm38) missense probably benign 0.01
R1880:Polq UTSW 16 37,086,592 (GRCm38) missense possibly damaging 0.90
R1932:Polq UTSW 16 37,062,304 (GRCm38) missense possibly damaging 0.92
R2008:Polq UTSW 16 37,062,482 (GRCm38) missense probably damaging 0.96
R2014:Polq UTSW 16 37,078,366 (GRCm38) missense probably damaging 1.00
R2026:Polq UTSW 16 37,062,745 (GRCm38) missense possibly damaging 0.93
R2178:Polq UTSW 16 37,062,829 (GRCm38) missense probably damaging 1.00
R2259:Polq UTSW 16 37,062,097 (GRCm38) missense probably benign 0.03
R2266:Polq UTSW 16 37,062,153 (GRCm38) missense possibly damaging 0.59
R2305:Polq UTSW 16 37,062,337 (GRCm38) missense probably damaging 0.99
R2370:Polq UTSW 16 37,073,939 (GRCm38) missense probably damaging 1.00
R2504:Polq UTSW 16 37,011,942 (GRCm38) missense unknown
R2517:Polq UTSW 16 37,089,325 (GRCm38) missense probably damaging 1.00
R2697:Polq UTSW 16 37,042,153 (GRCm38) missense probably damaging 1.00
R2858:Polq UTSW 16 37,062,753 (GRCm38) missense possibly damaging 0.88
R3436:Polq UTSW 16 37,062,337 (GRCm38) missense probably damaging 0.99
R3437:Polq UTSW 16 37,062,337 (GRCm38) missense probably damaging 0.99
R3699:Polq UTSW 16 37,042,156 (GRCm38) missense probably damaging 1.00
R3838:Polq UTSW 16 37,078,349 (GRCm38) missense probably damaging 1.00
R3875:Polq UTSW 16 37,074,027 (GRCm38) missense probably damaging 0.99
R4050:Polq UTSW 16 37,092,820 (GRCm38) critical splice acceptor site probably null
R4172:Polq UTSW 16 37,060,758 (GRCm38) missense probably benign 0.02
R4238:Polq UTSW 16 37,013,181 (GRCm38) missense probably damaging 1.00
R4240:Polq UTSW 16 37,013,181 (GRCm38) missense probably damaging 1.00
R4280:Polq UTSW 16 37,082,057 (GRCm38) missense probably damaging 1.00
R4296:Polq UTSW 16 37,061,301 (GRCm38) missense possibly damaging 0.94
R4360:Polq UTSW 16 37,060,339 (GRCm38) missense probably benign 0.00
R4373:Polq UTSW 16 37,013,181 (GRCm38) missense probably damaging 1.00
R4375:Polq UTSW 16 37,013,181 (GRCm38) missense probably damaging 1.00
R4376:Polq UTSW 16 37,013,181 (GRCm38) missense probably damaging 1.00
R4509:Polq UTSW 16 37,048,563 (GRCm38) missense probably damaging 1.00
R4510:Polq UTSW 16 37,048,563 (GRCm38) missense probably damaging 1.00
R4511:Polq UTSW 16 37,048,563 (GRCm38) missense probably damaging 1.00
R4543:Polq UTSW 16 37,060,785 (GRCm38) missense probably benign 0.43
R4633:Polq UTSW 16 37,048,542 (GRCm38) missense probably damaging 1.00
R4739:Polq UTSW 16 37,041,747 (GRCm38) missense probably damaging 1.00
R4834:Polq UTSW 16 37,027,814 (GRCm38) missense probably damaging 1.00
R4841:Polq UTSW 16 37,048,783 (GRCm38) critical splice donor site probably null
R4842:Polq UTSW 16 37,048,783 (GRCm38) critical splice donor site probably null
R4937:Polq UTSW 16 37,027,912 (GRCm38) missense probably benign 0.01
R4955:Polq UTSW 16 37,061,082 (GRCm38) missense probably benign 0.32
R4992:Polq UTSW 16 37,061,162 (GRCm38) missense possibly damaging 0.59
R5008:Polq UTSW 16 37,062,387 (GRCm38) missense probably benign
R5221:Polq UTSW 16 37,042,178 (GRCm38) missense probably damaging 0.98
R5254:Polq UTSW 16 37,089,319 (GRCm38) missense probably damaging 1.00
R5292:Polq UTSW 16 37,061,383 (GRCm38) missense probably damaging 1.00
R5375:Polq UTSW 16 37,082,784 (GRCm38) missense probably damaging 1.00
R5480:Polq UTSW 16 37,013,290 (GRCm38) splice site probably benign
R5552:Polq UTSW 16 37,094,510 (GRCm38) missense possibly damaging 0.93
R5591:Polq UTSW 16 37,011,885 (GRCm38) utr 5 prime probably benign
R5653:Polq UTSW 16 37,040,534 (GRCm38) missense probably damaging 1.00
R5708:Polq UTSW 16 37,061,018 (GRCm38) missense probably damaging 0.98
R5754:Polq UTSW 16 37,017,263 (GRCm38) missense probably benign
R5757:Polq UTSW 16 37,086,681 (GRCm38) missense probably benign 0.01
R5764:Polq UTSW 16 37,017,344 (GRCm38) missense probably damaging 0.97
R6019:Polq UTSW 16 37,061,764 (GRCm38) missense probably damaging 1.00
R6170:Polq UTSW 16 37,045,812 (GRCm38) missense possibly damaging 0.82
R6177:Polq UTSW 16 37,071,709 (GRCm38) missense probably damaging 0.98
R6307:Polq UTSW 16 37,017,356 (GRCm38) critical splice donor site probably null
R6499:Polq UTSW 16 37,060,827 (GRCm38) missense probably benign 0.03
R6520:Polq UTSW 16 37,060,377 (GRCm38) missense possibly damaging 0.88
R6598:Polq UTSW 16 37,061,631 (GRCm38) missense probably benign 0.39
R6694:Polq UTSW 16 37,015,173 (GRCm38) missense probably null 0.99
R6788:Polq UTSW 16 37,077,148 (GRCm38) missense probably damaging 1.00
R7104:Polq UTSW 16 37,089,353 (GRCm38) nonsense probably null
R7159:Polq UTSW 16 37,062,853 (GRCm38) missense possibly damaging 0.87
R7222:Polq UTSW 16 37,086,633 (GRCm38) nonsense probably null
R7340:Polq UTSW 16 37,060,926 (GRCm38) missense probably benign 0.00
R7361:Polq UTSW 16 37,060,428 (GRCm38) missense probably benign 0.00
R7384:Polq UTSW 16 37,029,418 (GRCm38) missense probably damaging 1.00
R7509:Polq UTSW 16 37,060,344 (GRCm38) missense probably benign 0.00
R7509:Polq UTSW 16 37,060,343 (GRCm38) missense probably benign
R7575:Polq UTSW 16 37,091,134 (GRCm38) missense probably benign 0.00
R7785:Polq UTSW 16 37,027,877 (GRCm38) missense probably damaging 1.00
R7787:Polq UTSW 16 37,017,309 (GRCm38) missense probably damaging 1.00
R7891:Polq UTSW 16 37,027,882 (GRCm38) missense probably damaging 1.00
R7917:Polq UTSW 16 37,065,288 (GRCm38) missense probably benign 0.08
R7940:Polq UTSW 16 37,060,642 (GRCm38) missense probably benign 0.27
R8028:Polq UTSW 16 37,061,316 (GRCm38) missense possibly damaging 0.82
R8114:Polq UTSW 16 37,042,215 (GRCm38) missense possibly damaging 0.94
R8144:Polq UTSW 16 37,029,484 (GRCm38) missense probably benign 0.01
R8288:Polq UTSW 16 37,027,910 (GRCm38) missense probably damaging 1.00
R8301:Polq UTSW 16 37,061,819 (GRCm38) missense probably damaging 1.00
R8341:Polq UTSW 16 37,071,771 (GRCm38) missense possibly damaging 0.96
R8348:Polq UTSW 16 37,017,197 (GRCm38) critical splice acceptor site probably null
R8448:Polq UTSW 16 37,017,197 (GRCm38) critical splice acceptor site probably null
R8815:Polq UTSW 16 37,033,531 (GRCm38) missense probably damaging 1.00
R8843:Polq UTSW 16 37,011,918 (GRCm38) missense unknown
R8878:Polq UTSW 16 37,040,507 (GRCm38) missense probably benign 0.02
R9016:Polq UTSW 16 37,022,797 (GRCm38) missense probably damaging 1.00
R9189:Polq UTSW 16 37,044,903 (GRCm38) missense probably damaging 1.00
R9209:Polq UTSW 16 37,048,649 (GRCm38) missense possibly damaging 0.94
R9352:Polq UTSW 16 37,041,890 (GRCm38) missense probably damaging 0.98
R9398:Polq UTSW 16 37,061,032 (GRCm38) missense probably benign 0.02
R9403:Polq UTSW 16 37,061,853 (GRCm38) missense probably benign 0.00
R9489:Polq UTSW 16 37,022,811 (GRCm38) missense probably benign 0.00
R9605:Polq UTSW 16 37,022,811 (GRCm38) missense probably benign 0.00
R9664:Polq UTSW 16 37,027,814 (GRCm38) missense probably damaging 0.98
R9801:Polq UTSW 16 37,092,828 (GRCm38) missense probably damaging 1.00
X0060:Polq UTSW 16 37,017,237 (GRCm38) nonsense probably null
Z1176:Polq UTSW 16 37,042,257 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCCTTTGTTCTGTCAATGAG -3'
(R):5'- GGTCTGTAGGCATAATGACTGC -3'

Sequencing Primer
(F):5'- TGCTAAGGCTTGAACCCATG -3'
(R):5'- AGGCATAATGACTGCTAAATTACAAG -3'
Posted On 2019-12-20