Mutagenetix > Incidental Mutation

Incidental Mutation 'R7898:Myom1'

609848

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7898 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71045752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 357 (L357P)

Ref Sequence

ENSEMBL: ENSMUSP00000072945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

PDB Structure

Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024847
AA Change: L357P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: L357P

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073211
AA Change: L357P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: L357P

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179759
AA Change: L357P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: L357P

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
4931409K22Rik	T	C	5: 24,553,645	E117G	probably damaging	Het
Acaca	T	C	11: 84,364,449		probably null	Het
Ankef1	C	A	2: 136,553,698	N649K	probably benign	Het
Arl5b	T	A	2: 15,075,058	S147T	probably damaging	Het
Arnt2	A	T	7: 84,268,947		probably null	Het
Ash1l	A	G	3: 88,983,625	E937G	possibly damaging	Het
Asxl1	T	G	2: 153,399,934	S802R	possibly damaging	Het
B230118H07Rik	T	A	2: 101,586,402	K67N	probably benign	Het
BC017158	C	A	7: 128,298,005	A27S	probably benign	Het
Cacna1h	T	A	17: 25,392,276	H516L	probably damaging	Het
Cad	A	G	5: 31,061,485	Y550C	probably damaging	Het
Cdo1	A	G	18: 46,728,090	I18T	probably benign	Het
Chd2	A	G	7: 73,519,475		probably null	Het
Dbf4	A	G	5: 8,408,232		probably null	Het
Dcdc2a	A	T	13: 25,102,378	R132W	possibly damaging	Het
Dnah10	T	C	5: 124,782,361	S2131P	probably damaging	Het
Eef2k	A	G	7: 120,895,218	Y599C	probably damaging	Het
Eno2	C	T	6: 124,767,262		probably null	Het
Fam124b	T	A	1: 80,213,795		probably benign	Het
Fezf2	A	G	14: 12,342,701	I388T	possibly damaging	Het
Gbp11	T	C	5: 105,324,932	N542S	probably benign	Het
Gdpd1	T	A	11: 87,041,813	I229F	probably damaging	Het
Gm5065	G	A	7: 5,359,442	R24H	probably benign	Het
Gria1	T	A	11: 57,242,765	V490E	probably damaging	Het
Grm8	G	A	6: 27,762,423	R268C	probably damaging	Het
Hectd4	T	A	5: 121,331,817	S2592T	probably benign	Het
Herpud1	C	T	8: 94,392,200	T194I	probably benign	Het
Hspa1b	T	C	17: 34,958,191	T273A	probably benign	Het
Ighm	T	A	12: 113,421,253	K327*	probably null	Het
Igkv3-4	A	T	6: 70,672,313	I99F	probably damaging	Het
Isl2	C	A	9: 55,542,439	S97R	probably benign	Het
Klhl12	A	T	1: 134,458,481	I4F	probably benign	Het
Lrp2	T	C	2: 69,441,366	E4074G	probably benign	Het
Mcm3ap	A	G	10: 76,506,607	N1645D	probably damaging	Het
Mettl23	T	C	11: 116,845,853		probably benign	Het
Mettl24	A	G	10: 40,810,482	E285G	probably benign	Het
Mis18bp1	A	G	12: 65,149,472	L506P	probably benign	Het
Mup18	G	T	4: 61,672,688		probably null	Het
Nkx2-9	G	A	12: 56,612,246	A61V	probably benign	Het
Olfr669	C	T	7: 104,939,366	A280V	probably damaging	Het
Pbx1	A	T	1: 168,185,047	M340K	probably benign	Het
Pcdhb17	A	T	18: 37,485,180	N8Y	probably benign	Het
Pex13	C	A	11: 23,650,929		probably null	Het
Plxnb1	A	G	9: 109,114,340	R1884G	probably damaging	Het
Polq	T	A	16: 37,044,883	V699E	probably damaging	Het
Ppl	C	T	16: 5,088,861	R1190H	probably damaging	Het
Prr14l	A	T	5: 32,829,966	H728Q	probably benign	Het
Prss12	T	C	3: 123,506,496	V752A	possibly damaging	Het
Prss56	A	G	1: 87,184,199	S51G	probably benign	Het
Pwp2	G	A	10: 78,173,406	R854W	probably damaging	Het
Rhobtb2	C	T	14: 69,796,297	C493Y	probably damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Scap	A	G	9: 110,384,743	N1258S	possibly damaging	Het
Sec31a	C	T	5: 100,399,477	G218R	probably damaging	Het
Siglec15	A	T	18: 78,043,699	M315K	probably benign	Het
Slc17a6	G	A	7: 51,658,825		probably null	Het
Smchd1	T	C	17: 71,377,818		probably null	Het
Spag4	A	T	2: 156,069,324	D393V	probably damaging	Het
Spata5	T	G	3: 37,420,471	M44R	probably benign	Het
Sulf1	A	G	1: 12,805,294	N176S	probably damaging	Het
Tmem9	T	A	1: 136,027,387		probably null	Het
Tnpo3	T	C	6: 29,565,224	I577V	probably benign	Het
Tti1	A	C	2: 157,993,470	I956S	probably benign	Het
Wdr66	A	T	5: 123,322,454	I1160F	probably damaging	Het
Wdr81	T	C	11: 75,453,899	R181G	probably benign	Het
Zfp462	T	A	4: 55,012,995	C1654S	probably damaging	Het
Zfp74	A	T	7: 29,935,955	C109*	probably null	Het
Znrf4	A	G	17: 56,511,681	C209R	probably damaging	Het
Zzef1	T	G	11: 72,796,547	L84R	probably damaging	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- CTCGGCGATGAATGTTCAAGG -3'
(R):5'- GTGCACATTATATCCAACCTAGCATG -3'

Sequencing Primer
(F):5'- TGTTCAAGGAGAGCTGTCAGC -3'
(R):5'- GCATGTCCTAATACATAAGTACTGTG -3'

Posted On

2019-12-20