Incidental Mutation 'R7899:Ryr3'
ID609861
Institutional Source Beutler Lab
Gene Symbol Ryr3
Ensembl Gene ENSMUSG00000057378
Gene Nameryanodine receptor 3
Synonymscalcium release channel isoform 3
MMRRC Submission
Accession Numbers

Genbank: NM_177652.2

Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R7899 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112631355-113217096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112646950 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 4507 (L4507Q)
Ref Sequence ENSEMBL: ENSMUSP00000089426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]
Predicted Effect probably damaging
Transcript: ENSMUST00000080673
AA Change: L4482Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: L4482Q

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
MIR 100 155 3.27e-4 SMART
MIR 162 207 7.52e-4 SMART
MIR 215 269 8.06e-4 SMART
MIR 275 368 8.4e-25 SMART
Pfam:RYDR_ITPR 438 642 1.1e-71 PFAM
SPRY 657 795 1.16e-24 SMART
Pfam:RyR 848 942 1.5e-34 PFAM
Pfam:RyR 962 1056 1.2e-32 PFAM
SPRY 1084 1207 7.99e-37 SMART
SPRY 1325 1465 6.25e-30 SMART
low complexity region 1757 1772 N/A INTRINSIC
low complexity region 1773 1788 N/A INTRINSIC
low complexity region 1932 1957 N/A INTRINSIC
Pfam:RYDR_ITPR 2018 2228 1.8e-59 PFAM
Pfam:RyR 2595 2689 1.2e-36 PFAM
Pfam:RyR 2713 2801 2.1e-31 PFAM
low complexity region 2877 2887 N/A INTRINSIC
low complexity region 3169 3184 N/A INTRINSIC
low complexity region 3327 3338 N/A INTRINSIC
PDB:2BCX|B 3462 3491 9e-12 PDB
low complexity region 3532 3540 N/A INTRINSIC
coiled coil region 3585 3614 N/A INTRINSIC
Pfam:RIH_assoc 3715 3848 4.9e-40 PFAM
low complexity region 3855 3875 N/A INTRINSIC
SCOP:d1sra__ 3893 3989 1e-10 SMART
low complexity region 4096 4134 N/A INTRINSIC
transmembrane domain 4178 4200 N/A INTRINSIC
Pfam:RR_TM4-6 4227 4497 4.7e-96 PFAM
Pfam:Ion_trans 4599 4762 2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000091818
AA Change: L4507Q

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: L4507Q

DomainStartEndE-ValueType
low complexity region 110 119 N/A INTRINSIC
MIR 120 175 3.27e-4 SMART
MIR 182 227 7.52e-4 SMART
MIR 235 289 8.06e-4 SMART
MIR 295 388 8.4e-25 SMART
Pfam:RYDR_ITPR 460 655 1.2e-64 PFAM
SPRY 677 815 1.16e-24 SMART
Pfam:RyR 869 959 3.3e-38 PFAM
Pfam:RyR 983 1073 2.5e-32 PFAM
SPRY 1104 1227 7.99e-37 SMART
SPRY 1345 1485 6.25e-30 SMART
low complexity region 1777 1792 N/A INTRINSIC
low complexity region 1793 1808 N/A INTRINSIC
low complexity region 1952 1977 N/A INTRINSIC
Pfam:RYDR_ITPR 2040 2248 5.8e-67 PFAM
Pfam:RyR 2616 2706 6.3e-33 PFAM
Pfam:RyR 2734 2818 6.6e-26 PFAM
low complexity region 2897 2907 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
PDB:2BCX|B 3487 3516 1e-11 PDB
low complexity region 3557 3565 N/A INTRINSIC
coiled coil region 3610 3639 N/A INTRINSIC
Pfam:RIH_assoc 3744 3862 3.5e-34 PFAM
low complexity region 3880 3900 N/A INTRINSIC
SCOP:d1sra__ 3918 4014 1e-10 SMART
low complexity region 4121 4159 N/A INTRINSIC
transmembrane domain 4203 4225 N/A INTRINSIC
Pfam:RR_TM4-6 4252 4522 1.1e-98 PFAM
Pfam:Ion_trans 4625 4799 6.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134358
AA Change: L4477Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208151
AA Change: L4453Q

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208290
AA Change: L4487Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,809,320 T49A possibly damaging Het
4932415D10Rik A G 10: 82,282,897 S4760P unknown Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Aagab T C 9: 63,616,850 F80L probably benign Het
Aox2 A G 1: 58,281,237 probably null Het
Arhgef2 T C 3: 88,621,262 S2P probably damaging Het
Bcar3 T G 3: 122,508,253 V199G probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1a G A 8: 84,594,173 V1587M possibly damaging Het
Caps2 C A 10: 112,165,761 S19Y possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cobll1 A G 2: 65,125,931 C328R probably damaging Het
Colec11 A C 12: 28,595,282 V130G probably damaging Het
Dennd5b A T 6: 149,041,661 D572E probably damaging Het
Dido1 A T 2: 180,671,597 S961T possibly damaging Het
Dnah7c A T 1: 46,514,701 M380L probably benign Het
Dnaic2 T C 11: 114,738,630 I161T probably benign Het
Dnttip2 T A 3: 122,282,369 M650K probably damaging Het
Dpp6 C T 5: 27,721,079 P717L probably benign Het
Epha10 A G 4: 124,914,835 E759G Het
Frmd4a T C 2: 4,604,089 W923R probably damaging Het
Ftsj3 C A 11: 106,252,289 E400* probably null Het
Gabra4 C A 5: 71,657,995 probably benign Het
Gfm1 T A 3: 67,473,527 N658K probably benign Het
Gm21560 A T 14: 6,218,220 I86N probably damaging Het
Gm6657 A G 12: 78,197,422 N50D Het
Gm9573 TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGGGTGGGGGTAGAGCCTGAG 17: 35,620,601 probably benign Het
Gpr68 C A 12: 100,878,448 C279F probably damaging Het
Hspg2 G A 4: 137,548,116 A2752T possibly damaging Het
Hydin A T 8: 110,587,748 D4288V probably benign Het
Ift74 A G 4: 94,621,977 T82A possibly damaging Het
Ints7 T A 1: 191,621,315 W918R probably damaging Het
Kcnc1 T A 7: 46,427,821 I349N probably damaging Het
Loxl1 C T 9: 58,290,834 D580N probably damaging Het
Mlph A T 1: 90,941,763 R496* probably null Het
Mtdh A G 15: 34,123,719 D364G possibly damaging Het
Mtmr11 C A 3: 96,170,428 L580I probably damaging Het
Muc16 T C 9: 18,640,697 I4767V probably benign Het
Myot A G 18: 44,354,184 T363A probably benign Het
Nfxl1 G A 5: 72,524,215 P658S probably damaging Het
Nhlrc3 A C 3: 53,461,659 S120A probably benign Het
Nmur2 C A 11: 56,040,335 Q183H probably benign Het
Nucb2 T A 7: 116,521,970 I45K probably benign Het
Nup155 A T 15: 8,119,179 D277V probably damaging Het
Olfr995 T C 2: 85,438,397 T254A probably benign Het
Orc1 T G 4: 108,603,371 probably null Het
Panx2 A G 15: 89,068,733 T468A possibly damaging Het
Pcdh7 A G 5: 57,719,810 S236G probably benign Het
Pcdhga2 G C 18: 37,670,857 G585R probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr T G 9: 8,903,742 M588R probably benign Het
Ptpn18 A T 1: 34,469,905 probably null Het
Rbm8a2 T A 1: 175,978,641 H90L probably benign Het
Serpina12 A G 12: 104,038,265 V36A probably benign Het
Sis T A 3: 72,937,251 S717C probably damaging Het
Slit2 A G 5: 48,247,185 E846G possibly damaging Het
Smr3a C T 5: 88,008,227 H85Y unknown Het
Sned1 G C 1: 93,274,082 R590P probably benign Het
Sult2a7 A G 7: 14,465,209 Y298H probably damaging Het
Syn3 A G 10: 86,064,929 V365A possibly damaging Het
Syne1 A T 10: 5,227,956 Y4839* probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tbl3 G T 17: 24,702,484 H478N probably damaging Het
Tcirg1 A T 19: 3,899,104 I395N probably damaging Het
Ticrr T C 7: 79,669,485 I406T probably benign Het
Tmem120a C A 5: 135,737,198 K123N probably benign Het
Tmem173 A G 18: 35,734,573 S357P probably damaging Het
Tmem184c A G 8: 77,597,811 V350A probably damaging Het
Tmem70 G T 1: 16,677,044 M128I probably benign Het
Tmx3 A T 18: 90,527,874 probably null Het
Topors G C 4: 40,260,356 S976W unknown Het
Trp53 T C 11: 69,590,693 L341P probably damaging Het
Usp14 T C 18: 10,000,563 K366E possibly damaging Het
Zbtb49 G T 5: 38,213,930 C202* probably null Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Ryr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ryr3 APN 2 112660149 missense probably damaging 0.98
IGL00531:Ryr3 APN 2 112663012 splice site probably benign
IGL00785:Ryr3 APN 2 112836103 missense possibly damaging 0.95
IGL00901:Ryr3 APN 2 112886589 missense probably damaging 1.00
IGL00910:Ryr3 APN 2 112728934 splice site probably benign
IGL00970:Ryr3 APN 2 112764676 missense probably damaging 1.00
IGL01083:Ryr3 APN 2 112751846 splice site probably benign
IGL01105:Ryr3 APN 2 112751805 missense probably damaging 1.00
IGL01287:Ryr3 APN 2 112709073 missense probably damaging 1.00
IGL01343:Ryr3 APN 2 112660054 missense probably damaging 1.00
IGL01472:Ryr3 APN 2 112672248 missense probably benign 0.20
IGL01552:Ryr3 APN 2 112825883 missense possibly damaging 0.53
IGL01594:Ryr3 APN 2 112772728 missense probably damaging 1.00
IGL01723:Ryr3 APN 2 112650111 critical splice donor site probably null
IGL01837:Ryr3 APN 2 112801320 missense probably damaging 1.00
IGL01868:Ryr3 APN 2 112803158 splice site probably benign
IGL01907:Ryr3 APN 2 112869001 splice site probably benign
IGL02005:Ryr3 APN 2 112663263 splice site probably benign
IGL02014:Ryr3 APN 2 112946915 missense possibly damaging 0.86
IGL02109:Ryr3 APN 2 112949157 missense probably benign
IGL02178:Ryr3 APN 2 112825799 missense probably benign 0.17
IGL02185:Ryr3 APN 2 112967203 missense probably damaging 0.99
IGL02189:Ryr3 APN 2 112754838 splice site probably benign
IGL02200:Ryr3 APN 2 112849510 missense probably damaging 0.98
IGL02302:Ryr3 APN 2 112964356 missense probably damaging 1.00
IGL02305:Ryr3 APN 2 112645277 missense probably damaging 0.96
IGL02306:Ryr3 APN 2 112834114 missense probably damaging 0.98
IGL02306:Ryr3 APN 2 112847399 critical splice donor site probably null
IGL02340:Ryr3 APN 2 112947004 splice site probably benign
IGL02398:Ryr3 APN 2 112847422 missense probably benign 0.05
IGL02407:Ryr3 APN 2 112754958 missense probably damaging 1.00
IGL02426:Ryr3 APN 2 112900905 missense possibly damaging 0.59
IGL02452:Ryr3 APN 2 112833990 missense probably damaging 1.00
IGL02453:Ryr3 APN 2 112681728 splice site probably benign
IGL02585:Ryr3 APN 2 112712303 missense probably damaging 1.00
IGL02724:Ryr3 APN 2 112902576 critical splice donor site probably null
IGL02817:Ryr3 APN 2 112844623 critical splice donor site probably null
IGL02861:Ryr3 APN 2 112652841 missense possibly damaging 0.89
IGL03038:Ryr3 APN 2 112668120 missense possibly damaging 0.83
IGL03059:Ryr3 APN 2 112800047 missense probably damaging 1.00
IGL03136:Ryr3 APN 2 112675974 splice site probably benign
IGL03137:Ryr3 APN 2 112910397 missense probably benign
IGL03166:Ryr3 APN 2 112641112 nonsense probably null
IGL03177:Ryr3 APN 2 113028671 missense probably benign 0.39
IGL03205:Ryr3 APN 2 112632142 missense probably damaging 1.00
IGL03224:Ryr3 APN 2 112954336 nonsense probably null
IGL03249:Ryr3 APN 2 112640656 missense probably benign 0.32
IGL03370:Ryr3 APN 2 112756599 missense possibly damaging 0.69
ANU74:Ryr3 UTSW 2 112831230 critical splice acceptor site probably null
BB006:Ryr3 UTSW 2 112834188 missense probably benign 0.00
BB016:Ryr3 UTSW 2 112834188 missense probably benign 0.00
F5426:Ryr3 UTSW 2 112766338 splice site probably benign
PIT4494001:Ryr3 UTSW 2 112841876 missense probably damaging 0.99
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0022:Ryr3 UTSW 2 112640666 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0051:Ryr3 UTSW 2 112869075 missense probably damaging 1.00
R0085:Ryr3 UTSW 2 112859763 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0097:Ryr3 UTSW 2 112800055 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0098:Ryr3 UTSW 2 112901031 missense probably damaging 1.00
R0116:Ryr3 UTSW 2 112803165 missense probably damaging 0.99
R0281:Ryr3 UTSW 2 112686810 missense probably damaging 1.00
R0302:Ryr3 UTSW 2 112647123 splice site probably benign
R0306:Ryr3 UTSW 2 112775655 critical splice donor site probably null
R0445:Ryr3 UTSW 2 112866054 missense probably benign 0.16
R0463:Ryr3 UTSW 2 112661701 missense probably damaging 1.00
R0592:Ryr3 UTSW 2 112678481 missense probably damaging 1.00
R0622:Ryr3 UTSW 2 112662555 missense probably damaging 1.00
R0656:Ryr3 UTSW 2 112648306 splice site probably benign
R0735:Ryr3 UTSW 2 112732982 missense probably benign 0.11
R0783:Ryr3 UTSW 2 112756327 splice site probably benign
R0789:Ryr3 UTSW 2 112780973 splice site probably null
R0835:Ryr3 UTSW 2 112650138 missense probably benign 0.16
R0879:Ryr3 UTSW 2 113030243 missense probably benign 0.02
R0924:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0930:Ryr3 UTSW 2 112841833 missense probably damaging 1.00
R0931:Ryr3 UTSW 2 112653702 missense probably damaging 1.00
R1037:Ryr3 UTSW 2 112869108 missense probably benign 0.42
R1169:Ryr3 UTSW 2 112733014 missense probably benign 0.01
R1170:Ryr3 UTSW 2 112946987 missense probably damaging 1.00
R1178:Ryr3 UTSW 2 112964380 missense probably benign 0.00
R1187:Ryr3 UTSW 2 112958176 missense probably damaging 1.00
R1289:Ryr3 UTSW 2 112645285 missense probably damaging 1.00
R1337:Ryr3 UTSW 2 112779963 missense possibly damaging 0.46
R1342:Ryr3 UTSW 2 112750803 missense probably damaging 1.00
R1349:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1372:Ryr3 UTSW 2 112834201 missense probably damaging 1.00
R1434:Ryr3 UTSW 2 112645259 missense probably damaging 1.00
R1438:Ryr3 UTSW 2 112757701 missense probably benign 0.18
R1467:Ryr3 UTSW 2 112753002 splice site probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1470:Ryr3 UTSW 2 112653007 missense probably benign
R1474:Ryr3 UTSW 2 112909962 missense probably damaging 1.00
R1481:Ryr3 UTSW 2 112636522 splice site probably benign
R1513:Ryr3 UTSW 2 112709197 nonsense probably null
R1524:Ryr3 UTSW 2 112869082 missense probably damaging 0.98
R1525:Ryr3 UTSW 2 112678090 missense probably damaging 1.00
R1526:Ryr3 UTSW 2 112661657 missense probably damaging 1.00
R1611:Ryr3 UTSW 2 112653505 missense possibly damaging 0.72
R1640:Ryr3 UTSW 2 112900833 missense probably damaging 1.00
R1662:Ryr3 UTSW 2 112709273 missense probably damaging 0.99
R1764:Ryr3 UTSW 2 112860460 missense probably damaging 1.00
R1769:Ryr3 UTSW 2 112751768 critical splice donor site probably null
R1776:Ryr3 UTSW 2 112957253 missense probably damaging 0.99
R1780:Ryr3 UTSW 2 112867292 missense probably damaging 0.98
R1840:Ryr3 UTSW 2 112750820 missense probably damaging 1.00
R1864:Ryr3 UTSW 2 112730328 missense possibly damaging 0.65
R1872:Ryr3 UTSW 2 112709137 missense possibly damaging 0.94
R1960:Ryr3 UTSW 2 112794467 missense probably damaging 1.00
R1994:Ryr3 UTSW 2 112654492 missense probably null 0.93
R2018:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2019:Ryr3 UTSW 2 112781065 missense probably benign 0.24
R2029:Ryr3 UTSW 2 112647016 missense possibly damaging 0.82
R2051:Ryr3 UTSW 2 112756641 missense probably damaging 1.00
R2060:Ryr3 UTSW 2 112954364 missense possibly damaging 0.92
R2061:Ryr3 UTSW 2 112663004 missense possibly damaging 0.83
R2067:Ryr3 UTSW 2 112946957 missense probably damaging 1.00
R2106:Ryr3 UTSW 2 112638129 missense probably damaging 1.00
R2129:Ryr3 UTSW 2 112678370 splice site probably benign
R2140:Ryr3 UTSW 2 112875148 missense probably benign 0.01
R2176:Ryr3 UTSW 2 112666335 missense possibly damaging 0.48
R2241:Ryr3 UTSW 2 112801392 missense probably damaging 1.00
R2261:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2262:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R2276:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2279:Ryr3 UTSW 2 112649319 missense possibly damaging 0.79
R2403:Ryr3 UTSW 2 112686628 missense probably damaging 1.00
R2510:Ryr3 UTSW 2 112675904 missense probably benign 0.18
R2568:Ryr3 UTSW 2 112675874 missense probably damaging 1.00
R3013:Ryr3 UTSW 2 112640281 missense probably damaging 1.00
R3431:Ryr3 UTSW 2 112656531 missense probably damaging 1.00
R3552:Ryr3 UTSW 2 112751787 missense probably damaging 1.00
R3761:Ryr3 UTSW 2 112754913 missense probably benign
R3909:Ryr3 UTSW 2 112636608 missense probably damaging 1.00
R3923:Ryr3 UTSW 2 112841873 missense possibly damaging 0.92
R3924:Ryr3 UTSW 2 113028703 splice site probably benign
R3927:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3947:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3949:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R3976:Ryr3 UTSW 2 112675837 missense possibly damaging 0.49
R4004:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4022:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4084:Ryr3 UTSW 2 112900908 missense probably damaging 0.99
R4106:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4108:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4109:Ryr3 UTSW 2 112675873 missense probably damaging 0.99
R4131:Ryr3 UTSW 2 112926983 splice site probably null
R4156:Ryr3 UTSW 2 112653675 missense probably damaging 1.00
R4172:Ryr3 UTSW 2 112794470 missense probably damaging 1.00
R4234:Ryr3 UTSW 2 112910407 missense probably damaging 1.00
R4399:Ryr3 UTSW 2 112946844 missense probably benign 0.01
R4409:Ryr3 UTSW 2 112730308 missense probably damaging 1.00
R4418:Ryr3 UTSW 2 112831224 missense probably damaging 1.00
R4466:Ryr3 UTSW 2 112653102 missense possibly damaging 0.92
R4525:Ryr3 UTSW 2 112653621 missense probably damaging 0.98
R4573:Ryr3 UTSW 2 112755174 splice site probably null
R4589:Ryr3 UTSW 2 112875133 missense probably damaging 1.00
R4653:Ryr3 UTSW 2 112652763 missense probably damaging 1.00
R4664:Ryr3 UTSW 2 112996555 intron probably benign
R4710:Ryr3 UTSW 2 112766301 missense probably damaging 1.00
R4734:Ryr3 UTSW 2 112910502 missense probably damaging 0.99
R4741:Ryr3 UTSW 2 112803268 missense probably damaging 0.99
R4748:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4749:Ryr3 UTSW 2 112964405 missense possibly damaging 0.95
R4754:Ryr3 UTSW 2 112757639 missense possibly damaging 0.94
R4764:Ryr3 UTSW 2 112733031 critical splice acceptor site probably null
R4812:Ryr3 UTSW 2 112912236 missense probably damaging 1.00
R4822:Ryr3 UTSW 2 112652745 missense probably damaging 1.00
R4841:Ryr3 UTSW 2 112648373 missense probably damaging 1.00
R4849:Ryr3 UTSW 2 112908462 missense probably damaging 1.00
R4917:Ryr3 UTSW 2 112831185 missense probably damaging 1.00
R4942:Ryr3 UTSW 2 112836257 missense probably damaging 0.99
R4990:Ryr3 UTSW 2 112635777 missense probably damaging 1.00
R4990:Ryr3 UTSW 2 112909973 missense probably damaging 1.00
R5049:Ryr3 UTSW 2 112640171 missense probably damaging 1.00
R5055:Ryr3 UTSW 2 112831159 missense probably benign 0.00
R5112:Ryr3 UTSW 2 112902665 missense probably damaging 1.00
R5160:Ryr3 UTSW 2 112646927 missense probably damaging 1.00
R5169:Ryr3 UTSW 2 112670660 missense possibly damaging 0.63
R5176:Ryr3 UTSW 2 112757667 missense possibly damaging 0.95
R5182:Ryr3 UTSW 2 112755150 missense probably damaging 1.00
R5206:Ryr3 UTSW 2 112844711 missense probably damaging 1.00
R5263:Ryr3 UTSW 2 112718002 missense possibly damaging 0.65
R5272:Ryr3 UTSW 2 112653213 missense probably damaging 1.00
R5332:Ryr3 UTSW 2 112902693 missense probably damaging 1.00
R5340:Ryr3 UTSW 2 112834125 missense probably damaging 0.99
R5359:Ryr3 UTSW 2 112775841 splice site probably null
R5434:Ryr3 UTSW 2 112794469 missense probably damaging 1.00
R5454:Ryr3 UTSW 2 112730302 splice site probably null
R5501:Ryr3 UTSW 2 112662504 missense possibly damaging 0.80
R5560:Ryr3 UTSW 2 112754877 missense probably damaging 1.00
R5580:Ryr3 UTSW 2 112841948 missense probably damaging 1.00
R5621:Ryr3 UTSW 2 112900984 nonsense probably null
R5731:Ryr3 UTSW 2 112641572 missense probably damaging 1.00
R5757:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5758:Ryr3 UTSW 2 112841975 missense probably damaging 1.00
R5768:Ryr3 UTSW 2 112753097 missense probably benign 0.05
R5783:Ryr3 UTSW 2 112652998 missense probably benign 0.06
R5799:Ryr3 UTSW 2 112686580 missense probably damaging 1.00
R5829:Ryr3 UTSW 2 112859731 missense probably damaging 1.00
R5883:Ryr3 UTSW 2 113030292 intron probably benign
R5911:Ryr3 UTSW 2 112908487 missense probably damaging 1.00
R5968:Ryr3 UTSW 2 112647049 missense probably benign 0.22
R5972:Ryr3 UTSW 2 112834064 missense probably damaging 0.99
R5978:Ryr3 UTSW 2 112672269 missense probably benign 0.00
R6084:Ryr3 UTSW 2 112908493 missense probably damaging 1.00
R6117:Ryr3 UTSW 2 112635396 missense probably damaging 1.00
R6126:Ryr3 UTSW 2 112757670 missense probably damaging 1.00
R6128:Ryr3 UTSW 2 112954294 critical splice donor site probably null
R6157:Ryr3 UTSW 2 112841899 missense probably damaging 0.98
R6258:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6260:Ryr3 UTSW 2 112660104 missense probably damaging 1.00
R6373:Ryr3 UTSW 2 112656544 missense probably damaging 1.00
R6377:Ryr3 UTSW 2 112632185 missense probably damaging 1.00
R6443:Ryr3 UTSW 2 112675933 missense possibly damaging 0.88
R6478:Ryr3 UTSW 2 112660068 missense probably damaging 1.00
R6512:Ryr3 UTSW 2 112867378 missense possibly damaging 0.83
R6684:Ryr3 UTSW 2 112753088 missense probably damaging 1.00
R6753:Ryr3 UTSW 2 112652610 missense probably damaging 0.99
R6812:Ryr3 UTSW 2 112946906 missense probably damaging 1.00
R6910:Ryr3 UTSW 2 112958175 missense probably damaging 1.00
R6930:Ryr3 UTSW 2 112860354 missense probably damaging 1.00
R6946:Ryr3 UTSW 2 112831200 missense probably damaging 1.00
R6950:Ryr3 UTSW 2 112686825 missense possibly damaging 0.78
R6973:Ryr3 UTSW 2 112766311 missense probably damaging 0.99
R6984:Ryr3 UTSW 2 112875091 missense probably damaging 1.00
R7020:Ryr3 UTSW 2 112753078 missense probably benign 0.00
R7037:Ryr3 UTSW 2 112949130 nonsense probably null
R7166:Ryr3 UTSW 2 112875028 missense probably damaging 1.00
R7172:Ryr3 UTSW 2 112661657 missense probably damaging 1.00
R7177:Ryr3 UTSW 2 112900843 missense probably damaging 1.00
R7188:Ryr3 UTSW 2 113028644 missense probably damaging 1.00
R7202:Ryr3 UTSW 2 112766319 missense probably damaging 1.00
R7228:Ryr3 UTSW 2 112861852 missense probably damaging 1.00
R7256:Ryr3 UTSW 2 112672246 nonsense probably null
R7293:Ryr3 UTSW 2 112902603 missense probably benign 0.13
R7331:Ryr3 UTSW 2 112763665 missense possibly damaging 0.80
R7380:Ryr3 UTSW 2 112640157 missense probably damaging 1.00
R7391:Ryr3 UTSW 2 112780977 critical splice donor site probably null
R7455:Ryr3 UTSW 2 112728866 missense probably damaging 0.99
R7466:Ryr3 UTSW 2 112926957 missense probably benign 0.40
R7481:Ryr3 UTSW 2 112678093 missense probably benign 0.16
R7481:Ryr3 UTSW 2 112678094 missense possibly damaging 0.95
R7497:Ryr3 UTSW 2 112730473 missense probably benign 0.06
R7502:Ryr3 UTSW 2 112712361 missense probably benign 0.00
R7505:Ryr3 UTSW 2 112712429 missense probably damaging 0.99
R7581:Ryr3 UTSW 2 112753027 missense probably damaging 0.99
R7606:Ryr3 UTSW 2 112645245 nonsense probably null
R7677:Ryr3 UTSW 2 112833900 missense probably benign
R7703:Ryr3 UTSW 2 112859765 missense probably damaging 1.00
R7713:Ryr3 UTSW 2 112635346 missense probably benign 0.12
R7784:Ryr3 UTSW 2 112775695 missense probably damaging 1.00
R7831:Ryr3 UTSW 2 112926838 missense possibly damaging 0.92
R7851:Ryr3 UTSW 2 112678517 missense probably benign 0.05
R7873:Ryr3 UTSW 2 112730428 missense probably benign 0.28
R7890:Ryr3 UTSW 2 112926912 missense probably damaging 1.00
R7904:Ryr3 UTSW 2 112781024 missense probably damaging 1.00
R7929:Ryr3 UTSW 2 112834188 missense probably benign 0.00
R7982:Ryr3 UTSW 2 112669249 small deletion probably benign
R8018:Ryr3 UTSW 2 112678432 missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112775664 missense probably damaging 1.00
R8043:Ryr3 UTSW 2 112875077 missense probably damaging 1.00
R8095:Ryr3 UTSW 2 112668043 critical splice donor site probably null
R8097:Ryr3 UTSW 2 112670270 splice site probably null
R8181:Ryr3 UTSW 2 112778243 missense probably damaging 0.98
R8276:Ryr3 UTSW 2 112640617 missense probably damaging 1.00
R8329:Ryr3 UTSW 2 112662510 missense possibly damaging 0.94
R8345:Ryr3 UTSW 2 112652925 missense probably benign 0.01
R8361:Ryr3 UTSW 2 112653130 missense probably damaging 0.98
R8421:Ryr3 UTSW 2 112996584 missense probably benign 0.00
R8424:Ryr3 UTSW 2 112841894 missense possibly damaging 0.91
R8505:Ryr3 UTSW 2 112675870 missense probably damaging 0.98
RF010:Ryr3 UTSW 2 112775670 missense probably damaging 0.97
RF040:Ryr3 UTSW 2 112910524 critical splice acceptor site probably benign
RF044:Ryr3 UTSW 2 112910524 critical splice acceptor site probably benign
X0057:Ryr3 UTSW 2 112640159 missense probably damaging 1.00
X0064:Ryr3 UTSW 2 112912302 missense probably benign 0.26
Z1088:Ryr3 UTSW 2 112900916 missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112675920 missense probably benign 0.05
Z1176:Ryr3 UTSW 2 112712374 missense probably damaging 1.00
Z1176:Ryr3 UTSW 2 112728924 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGGTGATTGAGATCCTGCAG -3'
(R):5'- ACTGAGGCTCCTTCTGATGG -3'

Sequencing Primer
(F):5'- ATTGAGATCCTGCAGTTGTAAGC -3'
(R):5'- TGTCTTGGGCCAGGTCAC -3'
Posted On2019-12-20