Incidental Mutation 'R7899:Taf4'
ID609862
Institutional Source Beutler Lab
Gene Symbol Taf4
Ensembl Gene ENSMUSG00000039117
Gene NameTATA-box binding protein associated factor 4
SynonymsTaf4a, Taf2c1, TAFII130, TAFII135
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7899 (G1)
Quality Score164.009
Status Validated
Chromosome2
Chromosomal Location179912152-179976646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 179932029 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 682 (T682M)
Ref Sequence ENSEMBL: ENSMUSP00000153863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]
Predicted Effect probably damaging
Transcript: ENSMUST00000041618
AA Change: T682M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: T682M

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 64 181 N/A INTRINSIC
SCOP:d1hqva_ 312 325 6e-3 SMART
low complexity region 339 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
internal_repeat_1 465 500 2.85e-5 PROSPERO
low complexity region 537 547 N/A INTRINSIC
TAFH 550 642 4.9e-54 SMART
internal_repeat_1 692 727 2.85e-5 PROSPERO
low complexity region 767 773 N/A INTRINSIC
Pfam:TAF4 791 1039 3.5e-81 PFAM
Predicted Effect not run
Transcript: ENSMUST00000131358
AA Change: T319M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154961
Predicted Effect probably damaging
Transcript: ENSMUST00000227325
AA Change: T682M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2230 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,809,320 T49A possibly damaging Het
4932415D10Rik A G 10: 82,282,897 S4760P unknown Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Aagab T C 9: 63,616,850 F80L probably benign Het
Aox2 A G 1: 58,281,237 probably null Het
Arhgef2 T C 3: 88,621,262 S2P probably damaging Het
Bcar3 T G 3: 122,508,253 V199G probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1a G A 8: 84,594,173 V1587M possibly damaging Het
Caps2 C A 10: 112,165,761 S19Y possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cobll1 A G 2: 65,125,931 C328R probably damaging Het
Colec11 A C 12: 28,595,282 V130G probably damaging Het
Dennd5b A T 6: 149,041,661 D572E probably damaging Het
Dido1 A T 2: 180,671,597 S961T possibly damaging Het
Dnah7c A T 1: 46,514,701 M380L probably benign Het
Dnaic2 T C 11: 114,738,630 I161T probably benign Het
Dnttip2 T A 3: 122,282,369 M650K probably damaging Het
Dpp6 C T 5: 27,721,079 P717L probably benign Het
Epha10 A G 4: 124,914,835 E759G Het
Frmd4a T C 2: 4,604,089 W923R probably damaging Het
Ftsj3 C A 11: 106,252,289 E400* probably null Het
Gabra4 C A 5: 71,657,995 probably benign Het
Gfm1 T A 3: 67,473,527 N658K probably benign Het
Gm21560 A T 14: 6,218,220 I86N probably damaging Het
Gm6657 A G 12: 78,197,422 N50D Het
Gm9573 TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGGGTGGGGGTAGAGCCTGAG 17: 35,620,601 probably benign Het
Gpr68 C A 12: 100,878,448 C279F probably damaging Het
Hspg2 G A 4: 137,548,116 A2752T possibly damaging Het
Hydin A T 8: 110,587,748 D4288V probably benign Het
Ift74 A G 4: 94,621,977 T82A possibly damaging Het
Ints7 T A 1: 191,621,315 W918R probably damaging Het
Kcnc1 T A 7: 46,427,821 I349N probably damaging Het
Loxl1 C T 9: 58,290,834 D580N probably damaging Het
Mlph A T 1: 90,941,763 R496* probably null Het
Mtdh A G 15: 34,123,719 D364G possibly damaging Het
Mtmr11 C A 3: 96,170,428 L580I probably damaging Het
Muc16 T C 9: 18,640,697 I4767V probably benign Het
Myot A G 18: 44,354,184 T363A probably benign Het
Nfxl1 G A 5: 72,524,215 P658S probably damaging Het
Nhlrc3 A C 3: 53,461,659 S120A probably benign Het
Nmur2 C A 11: 56,040,335 Q183H probably benign Het
Nucb2 T A 7: 116,521,970 I45K probably benign Het
Nup155 A T 15: 8,119,179 D277V probably damaging Het
Olfr995 T C 2: 85,438,397 T254A probably benign Het
Orc1 T G 4: 108,603,371 probably null Het
Panx2 A G 15: 89,068,733 T468A possibly damaging Het
Pcdh7 A G 5: 57,719,810 S236G probably benign Het
Pcdhga2 G C 18: 37,670,857 G585R probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr T G 9: 8,903,742 M588R probably benign Het
Ptpn18 A T 1: 34,469,905 probably null Het
Rbm8a2 T A 1: 175,978,641 H90L probably benign Het
Ryr3 A T 2: 112,646,950 L4507Q possibly damaging Het
Serpina12 A G 12: 104,038,265 V36A probably benign Het
Sis T A 3: 72,937,251 S717C probably damaging Het
Slit2 A G 5: 48,247,185 E846G possibly damaging Het
Smr3a C T 5: 88,008,227 H85Y unknown Het
Sned1 G C 1: 93,274,082 R590P probably benign Het
Sult2a7 A G 7: 14,465,209 Y298H probably damaging Het
Syn3 A G 10: 86,064,929 V365A possibly damaging Het
Syne1 A T 10: 5,227,956 Y4839* probably null Het
Tbl3 G T 17: 24,702,484 H478N probably damaging Het
Tcirg1 A T 19: 3,899,104 I395N probably damaging Het
Ticrr T C 7: 79,669,485 I406T probably benign Het
Tmem120a C A 5: 135,737,198 K123N probably benign Het
Tmem173 A G 18: 35,734,573 S357P probably damaging Het
Tmem184c A G 8: 77,597,811 V350A probably damaging Het
Tmem70 G T 1: 16,677,044 M128I probably benign Het
Tmx3 A T 18: 90,527,874 probably null Het
Topors G C 4: 40,260,356 S976W unknown Het
Trp53 T C 11: 69,590,693 L341P probably damaging Het
Usp14 T C 18: 10,000,563 K366E possibly damaging Het
Zbtb49 G T 5: 38,213,930 C202* probably null Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Taf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Taf4 APN 2 179976625 missense unknown
IGL00517:Taf4 APN 2 179924413 splice site probably benign
IGL02159:Taf4 APN 2 179938470 missense probably benign 0.24
IGL02254:Taf4 APN 2 179921184 missense probably benign 0.25
IGL03366:Taf4 APN 2 179935054 missense probably damaging 1.00
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R0049:Taf4 UTSW 2 179924091 missense probably damaging 0.98
R1267:Taf4 UTSW 2 179929324 missense possibly damaging 0.46
R1495:Taf4 UTSW 2 179933027 missense probably damaging 1.00
R1560:Taf4 UTSW 2 179935953 missense probably benign 0.14
R1756:Taf4 UTSW 2 179976531 missense unknown
R1893:Taf4 UTSW 2 179933030 missense probably damaging 0.98
R1932:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R2213:Taf4 UTSW 2 179935890 critical splice donor site probably null
R3896:Taf4 UTSW 2 179932014 missense probably benign 0.45
R4050:Taf4 UTSW 2 179932012 missense probably damaging 1.00
R4448:Taf4 UTSW 2 179935971 missense possibly damaging 0.65
R4736:Taf4 UTSW 2 179924494 missense probably damaging 1.00
R5124:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R6155:Taf4 UTSW 2 179913524 missense probably damaging 1.00
R6238:Taf4 UTSW 2 179932039 missense probably damaging 0.97
R6292:Taf4 UTSW 2 179923987 missense probably damaging 1.00
R7749:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7751:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7752:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7754:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7835:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7879:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7880:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7880:Taf4 UTSW 2 179935933 nonsense probably null
R7883:Taf4 UTSW 2 179929295 missense probably damaging 1.00
R7902:Taf4 UTSW 2 179932029 missense probably damaging 1.00
R7905:Taf4 UTSW 2 179932029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACACGTCTTTCCAGCAG -3'
(R):5'- ATGTTCCAGCTGTGCCTGAC -3'

Sequencing Primer
(F):5'- GGAGCTTCCTTGCCTGC -3'
(R):5'- AGCTTACCTGCCTTGAGACAG -3'
Posted On2019-12-20