Incidental Mutation 'R0682:Dpp10'
ID 60988
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
MMRRC Submission 038867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0682 (G1)
Quality Score 100
Status Not validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 123905125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 31 (A31S)
Ref Sequence ENSEMBL: ENSMUSP00000108222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: A31S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: A31S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112606
AA Change: A42S

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: A42S

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140361
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,840 H83R probably benign Het
Abcd3 A C 3: 121,769,567 I471S possibly damaging Het
Abcg1 G A 17: 31,111,251 V509I probably benign Het
Adamts9 A T 6: 92,903,802 N497K possibly damaging Het
Agap2 A G 10: 127,083,482 S479G unknown Het
Asic2 T C 11: 80,886,680 I402V possibly damaging Het
Atp1a2 G A 1: 172,284,597 T577I probably benign Het
Atraid T A 5: 31,052,268 I92K probably damaging Het
Erich6 A T 3: 58,636,811 F118L probably benign Het
Galnt18 T C 7: 111,520,015 Y418C probably damaging Het
Herc1 T A 9: 66,481,981 C3927S possibly damaging Het
Ifit2 G A 19: 34,573,612 R184H probably benign Het
Kif24 A T 4: 41,428,620 N113K probably benign Het
Lrp1b T A 2: 41,295,641 Y1354F probably benign Het
Muc1 T A 3: 89,231,132 I427N probably damaging Het
Muc5ac A G 7: 141,805,669 T1288A possibly damaging Het
Olfr1499 C T 19: 13,815,137 C151Y possibly damaging Het
Olfr850 C A 9: 19,477,349 M300I probably benign Het
Pex26 T A 6: 121,184,404 V47E probably damaging Het
Plekhm2 T C 4: 141,628,125 I871V probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Rnf133 A T 6: 23,649,570 I163N probably damaging Het
Rrp8 A C 7: 105,734,011 D349E probably damaging Het
Sdhd G T 9: 50,600,605 Q38K probably benign Het
Ssh1 C T 5: 113,960,657 S117N probably damaging Het
Tbc1d2b A G 9: 90,249,862 M148T probably benign Het
Tnni3k A G 3: 154,940,028 S470P probably damaging Het
Tnr C T 1: 159,852,307 Q284* probably null Het
Trim30a A C 7: 104,429,182 V229G probably damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Uck2 T C 1: 167,236,690 D90G probably damaging Het
Vmn1r229 A T 17: 20,814,688 E65V probably benign Het
Vmn2r26 A G 6: 124,061,170 E568G probably damaging Het
Whamm A G 7: 81,586,138 E363G probably damaging Het
Wrap53 A G 11: 69,562,446 S390P probably damaging Het
Wrn A G 8: 33,267,820 S814P probably benign Het
Zfp329 A G 7: 12,810,284 C438R probably damaging Het
Zkscan8 T C 13: 21,526,760 Y60C probably damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGACCACGAATCTCCTTAGCATC -3'
(R):5'- AGCACTTTGGCAGAGTCCTTTACC -3'

Sequencing Primer
(F):5'- TCCACAAATATCACCATGTCATTAGG -3'
(R):5'- GCAGAGTCCTTTACCTAGAGTTAATG -3'
Posted On 2013-07-30