Incidental Mutation 'R7899:Dennd5b'
ID 609887
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 045951-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7899 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 148943159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 572 (D572E)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: D572E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: D572E

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Meta Mutation Damage Score 0.4939 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,947,381 (GRCm39) T49A possibly damaging Het
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Aagab T C 9: 63,524,132 (GRCm39) F80L probably benign Het
Aox1 A G 1: 58,320,396 (GRCm39) probably null Het
Arhgef2 T C 3: 88,528,569 (GRCm39) S2P probably damaging Het
Bcar3 T G 3: 122,301,902 (GRCm39) V199G probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cacna1a G A 8: 85,320,802 (GRCm39) V1587M possibly damaging Het
Caps2 C A 10: 112,001,666 (GRCm39) S19Y possibly damaging Het
Ccdc196 A G 12: 78,244,196 (GRCm39) N50D Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cobll1 A G 2: 64,956,275 (GRCm39) C328R probably damaging Het
Colec11 A C 12: 28,645,281 (GRCm39) V130G probably damaging Het
Dido1 A T 2: 180,313,390 (GRCm39) S961T possibly damaging Het
Dnah7c A T 1: 46,553,861 (GRCm39) M380L probably benign Het
Dnai2 T C 11: 114,629,456 (GRCm39) I161T probably benign Het
Dnttip2 T A 3: 122,076,018 (GRCm39) M650K probably damaging Het
Dpp6 C T 5: 27,926,077 (GRCm39) P717L probably benign Het
Epha10 A G 4: 124,808,628 (GRCm39) E759G Het
Frmd4a T C 2: 4,608,900 (GRCm39) W923R probably damaging Het
Ftsj3 C A 11: 106,143,115 (GRCm39) E400* probably null Het
Gabra4 C A 5: 71,815,338 (GRCm39) probably benign Het
Gfm1 T A 3: 67,380,860 (GRCm39) N658K probably benign Het
Gm21560 A T 14: 6,218,220 (GRCm38) I86N probably damaging Het
Gpr68 C A 12: 100,844,707 (GRCm39) C279F probably damaging Het
Hspg2 G A 4: 137,275,427 (GRCm39) A2752T possibly damaging Het
Hydin A T 8: 111,314,380 (GRCm39) D4288V probably benign Het
Ift74 A G 4: 94,510,214 (GRCm39) T82A possibly damaging Het
Ints7 T A 1: 191,353,427 (GRCm39) W918R probably damaging Het
Kcnc1 T A 7: 46,077,245 (GRCm39) I349N probably damaging Het
Loxl1 C T 9: 58,198,117 (GRCm39) D580N probably damaging Het
Mlph A T 1: 90,869,485 (GRCm39) R496* probably null Het
Mtdh A G 15: 34,123,865 (GRCm39) D364G possibly damaging Het
Mtmr11 C A 3: 96,077,744 (GRCm39) L580I probably damaging Het
Muc16 T C 9: 18,551,993 (GRCm39) I4767V probably benign Het
Muc21 TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGGGTGGGGGTAGAGCCTGAG 17: 35,931,493 (GRCm39) probably benign Het
Myot A G 18: 44,487,251 (GRCm39) T363A probably benign Het
Nfxl1 G A 5: 72,681,558 (GRCm39) P658S probably damaging Het
Nhlrc3 A C 3: 53,369,080 (GRCm39) S120A probably benign Het
Nmur2 C A 11: 55,931,161 (GRCm39) Q183H probably benign Het
Nucb2 T A 7: 116,121,205 (GRCm39) I45K probably benign Het
Nup155 A T 15: 8,148,663 (GRCm39) D277V probably damaging Het
Or5ak25 T C 2: 85,268,741 (GRCm39) T254A probably benign Het
Orc1 T G 4: 108,460,568 (GRCm39) probably null Het
Panx2 A G 15: 88,952,936 (GRCm39) T468A possibly damaging Het
Pcdh7 A G 5: 57,877,152 (GRCm39) S236G probably benign Het
Pcdhga2 G C 18: 37,803,910 (GRCm39) G585R probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Pgr T G 9: 8,903,743 (GRCm39) M588R probably benign Het
Ptpn18 A T 1: 34,508,986 (GRCm39) probably null Het
Rbm8a2 T A 1: 175,806,207 (GRCm39) H90L probably benign Het
Ryr3 A T 2: 112,477,295 (GRCm39) L4507Q possibly damaging Het
Serpina12 A G 12: 104,004,524 (GRCm39) V36A probably benign Het
Sis T A 3: 72,844,584 (GRCm39) S717C probably damaging Het
Slit2 A G 5: 48,404,527 (GRCm39) E846G possibly damaging Het
Smr3a C T 5: 88,156,086 (GRCm39) H85Y unknown Het
Sned1 G C 1: 93,201,804 (GRCm39) R590P probably benign Het
Spata31h1 A G 10: 82,118,731 (GRCm39) S4760P unknown Het
Sting1 A G 18: 35,867,626 (GRCm39) S357P probably damaging Het
Sult2a7 A G 7: 14,199,134 (GRCm39) Y298H probably damaging Het
Syn3 A G 10: 85,900,793 (GRCm39) V365A possibly damaging Het
Syne1 A T 10: 5,177,956 (GRCm39) Y4839* probably null Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tbl3 G T 17: 24,921,458 (GRCm39) H478N probably damaging Het
Tcirg1 A T 19: 3,949,104 (GRCm39) I395N probably damaging Het
Ticrr T C 7: 79,319,233 (GRCm39) I406T probably benign Het
Tmem120a C A 5: 135,766,052 (GRCm39) K123N probably benign Het
Tmem184c A G 8: 78,324,440 (GRCm39) V350A probably damaging Het
Tmem70 G T 1: 16,747,268 (GRCm39) M128I probably benign Het
Tmx3 A T 18: 90,545,998 (GRCm39) probably null Het
Topors G C 4: 40,260,356 (GRCm39) S976W unknown Het
Trp53 T C 11: 69,481,519 (GRCm39) L341P probably damaging Het
Usp14 T C 18: 10,000,563 (GRCm39) K366E possibly damaging Het
Zbtb49 G T 5: 38,371,274 (GRCm39) C202* probably null Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCACTTAAAACATGTACGG -3'
(R):5'- AGCTCTAACTGGCCTAAAGTC -3'

Sequencing Primer
(F):5'- GTGGGTGCCCTTACATTA -3'
(R):5'- CAGATTTGCAAGACTTTTTAAATGCC -3'
Posted On 2019-12-20