Incidental Mutation 'R7899:Muc16'
ID 609896
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009, Gm21044
MMRRC Submission 045951-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.219) question?
Stock # R7899 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18406751-18585826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18551993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 4767 (I4767V)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208663]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: I4767V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,947,381 (GRCm39) T49A possibly damaging Het
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Aagab T C 9: 63,524,132 (GRCm39) F80L probably benign Het
Aox1 A G 1: 58,320,396 (GRCm39) probably null Het
Arhgef2 T C 3: 88,528,569 (GRCm39) S2P probably damaging Het
Bcar3 T G 3: 122,301,902 (GRCm39) V199G probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cacna1a G A 8: 85,320,802 (GRCm39) V1587M possibly damaging Het
Caps2 C A 10: 112,001,666 (GRCm39) S19Y possibly damaging Het
Ccdc196 A G 12: 78,244,196 (GRCm39) N50D Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cobll1 A G 2: 64,956,275 (GRCm39) C328R probably damaging Het
Colec11 A C 12: 28,645,281 (GRCm39) V130G probably damaging Het
Dennd5b A T 6: 148,943,159 (GRCm39) D572E probably damaging Het
Dido1 A T 2: 180,313,390 (GRCm39) S961T possibly damaging Het
Dnah7c A T 1: 46,553,861 (GRCm39) M380L probably benign Het
Dnai2 T C 11: 114,629,456 (GRCm39) I161T probably benign Het
Dnttip2 T A 3: 122,076,018 (GRCm39) M650K probably damaging Het
Dpp6 C T 5: 27,926,077 (GRCm39) P717L probably benign Het
Epha10 A G 4: 124,808,628 (GRCm39) E759G Het
Frmd4a T C 2: 4,608,900 (GRCm39) W923R probably damaging Het
Ftsj3 C A 11: 106,143,115 (GRCm39) E400* probably null Het
Gabra4 C A 5: 71,815,338 (GRCm39) probably benign Het
Gfm1 T A 3: 67,380,860 (GRCm39) N658K probably benign Het
Gm21560 A T 14: 6,218,220 (GRCm38) I86N probably damaging Het
Gpr68 C A 12: 100,844,707 (GRCm39) C279F probably damaging Het
Hspg2 G A 4: 137,275,427 (GRCm39) A2752T possibly damaging Het
Hydin A T 8: 111,314,380 (GRCm39) D4288V probably benign Het
Ift74 A G 4: 94,510,214 (GRCm39) T82A possibly damaging Het
Ints7 T A 1: 191,353,427 (GRCm39) W918R probably damaging Het
Kcnc1 T A 7: 46,077,245 (GRCm39) I349N probably damaging Het
Loxl1 C T 9: 58,198,117 (GRCm39) D580N probably damaging Het
Mlph A T 1: 90,869,485 (GRCm39) R496* probably null Het
Mtdh A G 15: 34,123,865 (GRCm39) D364G possibly damaging Het
Mtmr11 C A 3: 96,077,744 (GRCm39) L580I probably damaging Het
Muc21 TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGGGTGGGGGTAGAGCCTGAG 17: 35,931,493 (GRCm39) probably benign Het
Myot A G 18: 44,487,251 (GRCm39) T363A probably benign Het
Nfxl1 G A 5: 72,681,558 (GRCm39) P658S probably damaging Het
Nhlrc3 A C 3: 53,369,080 (GRCm39) S120A probably benign Het
Nmur2 C A 11: 55,931,161 (GRCm39) Q183H probably benign Het
Nucb2 T A 7: 116,121,205 (GRCm39) I45K probably benign Het
Nup155 A T 15: 8,148,663 (GRCm39) D277V probably damaging Het
Or5ak25 T C 2: 85,268,741 (GRCm39) T254A probably benign Het
Orc1 T G 4: 108,460,568 (GRCm39) probably null Het
Panx2 A G 15: 88,952,936 (GRCm39) T468A possibly damaging Het
Pcdh7 A G 5: 57,877,152 (GRCm39) S236G probably benign Het
Pcdhga2 G C 18: 37,803,910 (GRCm39) G585R probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Pgr T G 9: 8,903,743 (GRCm39) M588R probably benign Het
Ptpn18 A T 1: 34,508,986 (GRCm39) probably null Het
Rbm8a2 T A 1: 175,806,207 (GRCm39) H90L probably benign Het
Ryr3 A T 2: 112,477,295 (GRCm39) L4507Q possibly damaging Het
Serpina12 A G 12: 104,004,524 (GRCm39) V36A probably benign Het
Sis T A 3: 72,844,584 (GRCm39) S717C probably damaging Het
Slit2 A G 5: 48,404,527 (GRCm39) E846G possibly damaging Het
Smr3a C T 5: 88,156,086 (GRCm39) H85Y unknown Het
Sned1 G C 1: 93,201,804 (GRCm39) R590P probably benign Het
Spata31h1 A G 10: 82,118,731 (GRCm39) S4760P unknown Het
Sting1 A G 18: 35,867,626 (GRCm39) S357P probably damaging Het
Sult2a7 A G 7: 14,199,134 (GRCm39) Y298H probably damaging Het
Syn3 A G 10: 85,900,793 (GRCm39) V365A possibly damaging Het
Syne1 A T 10: 5,177,956 (GRCm39) Y4839* probably null Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tbl3 G T 17: 24,921,458 (GRCm39) H478N probably damaging Het
Tcirg1 A T 19: 3,949,104 (GRCm39) I395N probably damaging Het
Ticrr T C 7: 79,319,233 (GRCm39) I406T probably benign Het
Tmem120a C A 5: 135,766,052 (GRCm39) K123N probably benign Het
Tmem184c A G 8: 78,324,440 (GRCm39) V350A probably damaging Het
Tmem70 G T 1: 16,747,268 (GRCm39) M128I probably benign Het
Tmx3 A T 18: 90,545,998 (GRCm39) probably null Het
Topors G C 4: 40,260,356 (GRCm39) S976W unknown Het
Trp53 T C 11: 69,481,519 (GRCm39) L341P probably damaging Het
Usp14 T C 18: 10,000,563 (GRCm39) K366E possibly damaging Het
Zbtb49 G T 5: 38,371,274 (GRCm39) C202* probably null Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18,419,803 (GRCm39) missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18,406,839 (GRCm39) missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18,409,996 (GRCm39) missense probably damaging 0.99
IGL02553:Muc16 APN 9 18,409,849 (GRCm39) critical splice donor site probably null
Brimming UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
Runneymeade UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
slimey UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
viscous UTSW 9 18,556,028 (GRCm39) missense unknown
R0400:Muc16 UTSW 9 18,421,830 (GRCm39) missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18,421,773 (GRCm39) missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18,408,729 (GRCm39) missense probably damaging 1.00
R3196:Muc16 UTSW 9 18,409,126 (GRCm39) missense probably damaging 1.00
R5982:Muc16 UTSW 9 18,558,442 (GRCm39) missense unknown
R5990:Muc16 UTSW 9 18,570,539 (GRCm39) missense unknown
R6024:Muc16 UTSW 9 18,557,967 (GRCm39) missense unknown
R6026:Muc16 UTSW 9 18,571,154 (GRCm39) missense unknown
R6028:Muc16 UTSW 9 18,568,472 (GRCm39) missense unknown
R6083:Muc16 UTSW 9 18,568,508 (GRCm39) missense unknown
R6089:Muc16 UTSW 9 18,554,548 (GRCm39) missense unknown
R6109:Muc16 UTSW 9 18,566,655 (GRCm39) missense unknown
R6127:Muc16 UTSW 9 18,569,174 (GRCm39) missense unknown
R6130:Muc16 UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
R6146:Muc16 UTSW 9 18,409,093 (GRCm39) missense probably damaging 0.98
R6161:Muc16 UTSW 9 18,559,114 (GRCm39) missense unknown
R6164:Muc16 UTSW 9 18,469,675 (GRCm39) missense probably damaging 1.00
R6185:Muc16 UTSW 9 18,565,769 (GRCm39) missense unknown
R6192:Muc16 UTSW 9 18,569,985 (GRCm39) missense unknown
R6217:Muc16 UTSW 9 18,566,742 (GRCm39) missense unknown
R6232:Muc16 UTSW 9 18,568,294 (GRCm39) missense unknown
R6246:Muc16 UTSW 9 18,488,363 (GRCm39) splice site probably null
R6255:Muc16 UTSW 9 18,566,895 (GRCm39) missense unknown
R6280:Muc16 UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
R6286:Muc16 UTSW 9 18,555,685 (GRCm39) missense unknown
R6287:Muc16 UTSW 9 18,570,330 (GRCm39) missense unknown
R6307:Muc16 UTSW 9 18,558,884 (GRCm39) missense unknown
R6310:Muc16 UTSW 9 18,553,246 (GRCm39) missense probably benign 0.00
R6316:Muc16 UTSW 9 18,553,115 (GRCm39) missense probably benign 0.01
R6335:Muc16 UTSW 9 18,572,004 (GRCm39) missense unknown
R6345:Muc16 UTSW 9 18,566,222 (GRCm39) missense unknown
R6349:Muc16 UTSW 9 18,568,625 (GRCm39) missense unknown
R6366:Muc16 UTSW 9 18,557,340 (GRCm39) missense unknown
R6393:Muc16 UTSW 9 18,558,695 (GRCm39) nonsense probably null
R6440:Muc16 UTSW 9 18,552,655 (GRCm39) missense probably benign 0.01
R6458:Muc16 UTSW 9 18,553,017 (GRCm39) missense probably benign 0.01
R6460:Muc16 UTSW 9 18,551,812 (GRCm39) missense probably benign 0.01
R6481:Muc16 UTSW 9 18,461,973 (GRCm39) critical splice donor site probably null
R6539:Muc16 UTSW 9 18,548,621 (GRCm39) missense probably benign 0.25
R6551:Muc16 UTSW 9 18,473,858 (GRCm39) missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18,478,011 (GRCm39) missense probably benign 0.18
R6601:Muc16 UTSW 9 18,548,866 (GRCm39) missense probably benign 0.10
R6602:Muc16 UTSW 9 18,520,772 (GRCm39) splice site probably null
R6615:Muc16 UTSW 9 18,558,484 (GRCm39) missense unknown
R6625:Muc16 UTSW 9 18,571,574 (GRCm39) missense unknown
R6668:Muc16 UTSW 9 18,551,681 (GRCm39) missense probably benign 0.03
R6697:Muc16 UTSW 9 18,552,587 (GRCm39) missense probably benign 0.01
R6710:Muc16 UTSW 9 18,553,366 (GRCm39) missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18,477,986 (GRCm39) critical splice donor site probably null
R6789:Muc16 UTSW 9 18,471,282 (GRCm39) missense probably benign 0.40
R6806:Muc16 UTSW 9 18,449,206 (GRCm39) critical splice donor site probably null
R6874:Muc16 UTSW 9 18,570,065 (GRCm39) nonsense probably null
R6894:Muc16 UTSW 9 18,406,872 (GRCm39) missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18,553,959 (GRCm39) missense unknown
R6919:Muc16 UTSW 9 18,571,595 (GRCm39) missense unknown
R6939:Muc16 UTSW 9 18,549,833 (GRCm39) missense probably benign 0.04
R6953:Muc16 UTSW 9 18,551,825 (GRCm39) missense probably benign 0.01
R6956:Muc16 UTSW 9 18,556,322 (GRCm39) missense unknown
R6977:Muc16 UTSW 9 18,556,633 (GRCm39) missense unknown
R6996:Muc16 UTSW 9 18,557,193 (GRCm39) missense unknown
R7011:Muc16 UTSW 9 18,548,839 (GRCm39) missense probably benign 0.10
R7011:Muc16 UTSW 9 18,548,747 (GRCm39) missense probably benign 0.26
R7012:Muc16 UTSW 9 18,406,914 (GRCm39) critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18,569,532 (GRCm39) missense unknown
R7021:Muc16 UTSW 9 18,462,127 (GRCm39) splice site probably null
R7021:Muc16 UTSW 9 18,466,215 (GRCm39) missense unknown
R7038:Muc16 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
R7057:Muc16 UTSW 9 18,557,375 (GRCm39) missense unknown
R7058:Muc16 UTSW 9 18,551,051 (GRCm39) missense probably benign 0.10
R7066:Muc16 UTSW 9 18,569,317 (GRCm39) missense unknown
R7067:Muc16 UTSW 9 18,569,547 (GRCm39) missense unknown
R7070:Muc16 UTSW 9 18,557,219 (GRCm39) nonsense probably null
R7074:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7085:Muc16 UTSW 9 18,556,145 (GRCm39) missense unknown
R7088:Muc16 UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7107:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R7108:Muc16 UTSW 9 18,566,529 (GRCm39) missense unknown
R7126:Muc16 UTSW 9 18,552,512 (GRCm39) missense probably benign 0.01
R7128:Muc16 UTSW 9 18,554,300 (GRCm39) missense unknown
R7145:Muc16 UTSW 9 18,566,876 (GRCm39) missense unknown
R7179:Muc16 UTSW 9 18,553,304 (GRCm39) missense probably benign 0.00
R7194:Muc16 UTSW 9 18,585,750 (GRCm39) missense unknown
R7211:Muc16 UTSW 9 18,409,866 (GRCm39) missense probably damaging 1.00
R7213:Muc16 UTSW 9 18,552,712 (GRCm39) missense probably benign 0.01
R7217:Muc16 UTSW 9 18,555,372 (GRCm39) nonsense probably null
R7221:Muc16 UTSW 9 18,553,495 (GRCm39) missense probably benign 0.04
R7265:Muc16 UTSW 9 18,567,768 (GRCm39) missense unknown
R7326:Muc16 UTSW 9 18,496,309 (GRCm39) missense probably benign 0.03
R7359:Muc16 UTSW 9 18,554,316 (GRCm39) missense unknown
R7387:Muc16 UTSW 9 18,553,016 (GRCm39) missense probably benign 0.01
R7391:Muc16 UTSW 9 18,550,832 (GRCm39) missense probably benign 0.04
R7398:Muc16 UTSW 9 18,549,038 (GRCm39) missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18,553,258 (GRCm39) missense probably benign 0.01
R7431:Muc16 UTSW 9 18,519,289 (GRCm39) missense
R7484:Muc16 UTSW 9 18,558,064 (GRCm39) missense unknown
R7487:Muc16 UTSW 9 18,496,095 (GRCm39) missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18,556,385 (GRCm39) missense unknown
R7515:Muc16 UTSW 9 18,550,958 (GRCm39) missense probably benign 0.00
R7537:Muc16 UTSW 9 18,549,431 (GRCm39) missense probably benign 0.06
R7538:Muc16 UTSW 9 18,566,747 (GRCm39) missense unknown
R7538:Muc16 UTSW 9 18,553,427 (GRCm39) missense probably benign 0.10
R7543:Muc16 UTSW 9 18,556,028 (GRCm39) missense unknown
R7566:Muc16 UTSW 9 18,549,925 (GRCm39) missense probably benign 0.00
R7581:Muc16 UTSW 9 18,556,910 (GRCm39) missense unknown
R7594:Muc16 UTSW 9 18,556,358 (GRCm39) missense unknown
R7629:Muc16 UTSW 9 18,478,081 (GRCm39) missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18,519,018 (GRCm39) missense probably benign 0.08
R7666:Muc16 UTSW 9 18,469,723 (GRCm39) missense probably damaging 1.00
R7703:Muc16 UTSW 9 18,516,578 (GRCm39) missense
R7727:Muc16 UTSW 9 18,571,538 (GRCm39) missense unknown
R7743:Muc16 UTSW 9 18,568,773 (GRCm39) missense unknown
R7744:Muc16 UTSW 9 18,496,392 (GRCm39) critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18,491,870 (GRCm39) missense probably damaging 1.00
R7769:Muc16 UTSW 9 18,571,803 (GRCm39) missense unknown
R7805:Muc16 UTSW 9 18,549,789 (GRCm39) missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18,506,519 (GRCm39) missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18,552,069 (GRCm39) missense probably benign 0.01
R7849:Muc16 UTSW 9 18,551,801 (GRCm39) missense probably benign 0.01
R7884:Muc16 UTSW 9 18,553,990 (GRCm39) missense unknown
R7885:Muc16 UTSW 9 18,550,760 (GRCm39) missense probably benign 0.10
R7886:Muc16 UTSW 9 18,497,278 (GRCm39) missense probably benign 0.03
R7904:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7921:Muc16 UTSW 9 18,570,614 (GRCm39) missense unknown
R7922:Muc16 UTSW 9 18,496,121 (GRCm39) missense probably benign 0.16
R7948:Muc16 UTSW 9 18,553,786 (GRCm39) missense unknown
R7957:Muc16 UTSW 9 18,554,767 (GRCm39) missense unknown
R7972:Muc16 UTSW 9 18,557,060 (GRCm39) nonsense probably null
R7992:Muc16 UTSW 9 18,567,725 (GRCm39) missense unknown
R7998:Muc16 UTSW 9 18,551,188 (GRCm39) missense probably benign 0.04
R8014:Muc16 UTSW 9 18,566,171 (GRCm39) missense unknown
R8033:Muc16 UTSW 9 18,547,902 (GRCm39) missense probably benign 0.26
R8052:Muc16 UTSW 9 18,570,347 (GRCm39) missense unknown
R8058:Muc16 UTSW 9 18,571,298 (GRCm39) nonsense probably null
R8088:Muc16 UTSW 9 18,430,596 (GRCm39) nonsense probably null
R8095:Muc16 UTSW 9 18,496,126 (GRCm39) nonsense probably null
R8111:Muc16 UTSW 9 18,503,925 (GRCm39) missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18,570,033 (GRCm39) missense unknown
R8117:Muc16 UTSW 9 18,420,206 (GRCm39) nonsense probably null
R8137:Muc16 UTSW 9 18,556,972 (GRCm39) missense unknown
R8196:Muc16 UTSW 9 18,556,630 (GRCm39) missense unknown
R8218:Muc16 UTSW 9 18,548,315 (GRCm39) missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18,554,273 (GRCm39) missense unknown
R8313:Muc16 UTSW 9 18,436,443 (GRCm39) missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18,569,339 (GRCm39) missense unknown
R8342:Muc16 UTSW 9 18,569,981 (GRCm39) missense unknown
R8351:Muc16 UTSW 9 18,571,181 (GRCm39) missense unknown
R8356:Muc16 UTSW 9 18,570,074 (GRCm39) missense unknown
R8360:Muc16 UTSW 9 18,436,554 (GRCm39) missense probably benign 0.01
R8418:Muc16 UTSW 9 18,430,926 (GRCm39) missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18,448,807 (GRCm39) missense probably damaging 0.99
R8437:Muc16 UTSW 9 18,569,220 (GRCm39) missense unknown
R8463:Muc16 UTSW 9 18,570,435 (GRCm39) missense unknown
R8466:Muc16 UTSW 9 18,554,444 (GRCm39) missense unknown
R8512:Muc16 UTSW 9 18,549,488 (GRCm39) missense probably benign 0.01
R8518:Muc16 UTSW 9 18,430,927 (GRCm39) missense probably benign 0.12
R8556:Muc16 UTSW 9 18,552,233 (GRCm39) missense probably benign 0.01
R8679:Muc16 UTSW 9 18,557,744 (GRCm39) missense unknown
R8680:Muc16 UTSW 9 18,556,015 (GRCm39) missense unknown
R8720:Muc16 UTSW 9 18,552,896 (GRCm39) missense probably benign 0.01
R8729:Muc16 UTSW 9 18,571,346 (GRCm39) missense unknown
R8736:Muc16 UTSW 9 18,462,139 (GRCm39) nonsense probably null
R8739:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R8807:Muc16 UTSW 9 18,567,353 (GRCm39) missense unknown
R8830:Muc16 UTSW 9 18,557,365 (GRCm39) missense unknown
R8871:Muc16 UTSW 9 18,567,344 (GRCm39) missense unknown
R8884:Muc16 UTSW 9 18,555,496 (GRCm39) missense unknown
R8923:Muc16 UTSW 9 18,549,972 (GRCm39) missense probably benign 0.01
R8948:Muc16 UTSW 9 18,558,529 (GRCm39) missense unknown
R8949:Muc16 UTSW 9 18,432,221 (GRCm39) critical splice donor site probably null
R8987:Muc16 UTSW 9 18,462,981 (GRCm39) nonsense probably null
R8997:Muc16 UTSW 9 18,518,763 (GRCm39) intron probably benign
R9013:Muc16 UTSW 9 18,424,069 (GRCm39) missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18,550,015 (GRCm39) small insertion probably benign
R9036:Muc16 UTSW 9 18,555,975 (GRCm39) missense unknown
R9040:Muc16 UTSW 9 18,556,082 (GRCm39) nonsense probably null
R9065:Muc16 UTSW 9 18,554,305 (GRCm39) missense unknown
R9089:Muc16 UTSW 9 18,555,846 (GRCm39) missense unknown
R9098:Muc16 UTSW 9 18,554,975 (GRCm39) missense unknown
R9100:Muc16 UTSW 9 18,556,966 (GRCm39) missense unknown
R9128:Muc16 UTSW 9 18,558,878 (GRCm39) missense unknown
R9169:Muc16 UTSW 9 18,567,824 (GRCm39) missense unknown
R9180:Muc16 UTSW 9 18,554,038 (GRCm39) missense unknown
R9191:Muc16 UTSW 9 18,556,106 (GRCm39) missense unknown
R9203:Muc16 UTSW 9 18,462,984 (GRCm39) missense unknown
R9208:Muc16 UTSW 9 18,419,833 (GRCm39) missense probably damaging 0.99
R9232:Muc16 UTSW 9 18,567,336 (GRCm39) missense unknown
R9240:Muc16 UTSW 9 18,449,309 (GRCm39) missense unknown
R9254:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9330:Muc16 UTSW 9 18,552,332 (GRCm39) missense probably benign 0.04
R9347:Muc16 UTSW 9 18,571,511 (GRCm39) missense unknown
R9358:Muc16 UTSW 9 18,553,520 (GRCm39) missense probably benign 0.01
R9359:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9379:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9403:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9422:Muc16 UTSW 9 18,553,102 (GRCm39) missense probably benign 0.01
R9433:Muc16 UTSW 9 18,483,937 (GRCm39) missense probably benign 0.09
R9438:Muc16 UTSW 9 18,559,028 (GRCm39) missense unknown
R9442:Muc16 UTSW 9 18,566,624 (GRCm39) missense unknown
R9453:Muc16 UTSW 9 18,572,061 (GRCm39) missense unknown
R9467:Muc16 UTSW 9 18,508,331 (GRCm39) missense probably benign 0.03
R9490:Muc16 UTSW 9 18,568,149 (GRCm39) nonsense probably null
R9519:Muc16 UTSW 9 18,498,216 (GRCm39) missense probably benign 0.03
R9524:Muc16 UTSW 9 18,497,314 (GRCm39) missense probably benign 0.03
R9556:Muc16 UTSW 9 18,569,934 (GRCm39) missense unknown
R9583:Muc16 UTSW 9 18,549,973 (GRCm39) missense probably benign 0.01
R9600:Muc16 UTSW 9 18,567,147 (GRCm39) missense unknown
R9638:Muc16 UTSW 9 18,550,626 (GRCm39) missense probably benign 0.12
R9650:Muc16 UTSW 9 18,553,762 (GRCm39) missense unknown
R9652:Muc16 UTSW 9 18,498,178 (GRCm39) missense probably benign 0.03
R9666:Muc16 UTSW 9 18,567,285 (GRCm39) missense unknown
R9682:Muc16 UTSW 9 18,553,874 (GRCm39) missense unknown
R9765:Muc16 UTSW 9 18,548,494 (GRCm39) missense probably benign 0.16
R9766:Muc16 UTSW 9 18,552,383 (GRCm39) missense probably benign 0.01
R9766:Muc16 UTSW 9 18,548,153 (GRCm39) missense probably benign 0.08
R9776:Muc16 UTSW 9 18,570,675 (GRCm39) missense unknown
R9782:Muc16 UTSW 9 18,548,066 (GRCm39) missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18,569,157 (GRCm39) nonsense probably null
Z1177:Muc16 UTSW 9 18,448,867 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTCATTGTCTCTGCAGAACTTG -3'
(R):5'- CCTTCTTCACCTGGGCTAGAAG -3'

Sequencing Primer
(F):5'- CATTGTCTCTGCAGAACTTGTTGAG -3'
(R):5'- CTTCACCTGGGCTAGAAGAAACTAAG -3'
Posted On 2019-12-20