Incidental Mutation 'R7899:Loxl1'
ID609897
Institutional Source Beutler Lab
Gene Symbol Loxl1
Ensembl Gene ENSMUSG00000032334
Gene Namelysyl oxidase-like 1
SynonymsLOXL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7899 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58287738-58313186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58290834 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 580 (D580N)
Ref Sequence ENSEMBL: ENSMUSP00000057406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061799]
Predicted Effect probably damaging
Transcript: ENSMUST00000061799
AA Change: D580N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057406
Gene: ENSMUSG00000032334
AA Change: D580N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 82 96 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
Pfam:Lysyl_oxidase 403 604 5.1e-98 PFAM
Meta Mutation Damage Score 0.7789 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: This gene encodes a member of the lysyl oxidase family of copper-dependent enzymes that catalyze the formation of lysine-derived crosslinks in proteins such as collagen and elastin. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional enzyme. Mice lacking the encoded protein fail to deposit normal elastic fibers in the uterine tract post partum and develop pelvic organ prolapse, enlarged airspaces of the lung, loose skin and vascular abnormalities with concomitant tropoelastin accumulation. [provided by RefSeq, Sep 2016]
PHENOTYPE: Elastic fiber homeostasis is disrupted in homozygous mutant mice, resulting in loose skin, abnormal lung morphology, intestinal defects, and post partum uterine prolapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,809,320 T49A possibly damaging Het
4932415D10Rik A G 10: 82,282,897 S4760P unknown Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Aagab T C 9: 63,616,850 F80L probably benign Het
Aox2 A G 1: 58,281,237 probably null Het
Arhgef2 T C 3: 88,621,262 S2P probably damaging Het
Bcar3 T G 3: 122,508,253 V199G probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1a G A 8: 84,594,173 V1587M possibly damaging Het
Caps2 C A 10: 112,165,761 S19Y possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cobll1 A G 2: 65,125,931 C328R probably damaging Het
Colec11 A C 12: 28,595,282 V130G probably damaging Het
Dennd5b A T 6: 149,041,661 D572E probably damaging Het
Dido1 A T 2: 180,671,597 S961T possibly damaging Het
Dnah7c A T 1: 46,514,701 M380L probably benign Het
Dnaic2 T C 11: 114,738,630 I161T probably benign Het
Dnttip2 T A 3: 122,282,369 M650K probably damaging Het
Dpp6 C T 5: 27,721,079 P717L probably benign Het
Epha10 A G 4: 124,914,835 E759G Het
Frmd4a T C 2: 4,604,089 W923R probably damaging Het
Ftsj3 C A 11: 106,252,289 E400* probably null Het
Gabra4 C A 5: 71,657,995 probably benign Het
Gfm1 T A 3: 67,473,527 N658K probably benign Het
Gm21560 A T 14: 6,218,220 I86N probably damaging Het
Gm6657 A G 12: 78,197,422 N50D Het
Gm9573 TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGGGTGGGGGTAGAGCCTGAG 17: 35,620,601 probably benign Het
Gpr68 C A 12: 100,878,448 C279F probably damaging Het
Hspg2 G A 4: 137,548,116 A2752T possibly damaging Het
Hydin A T 8: 110,587,748 D4288V probably benign Het
Ift74 A G 4: 94,621,977 T82A possibly damaging Het
Ints7 T A 1: 191,621,315 W918R probably damaging Het
Kcnc1 T A 7: 46,427,821 I349N probably damaging Het
Mlph A T 1: 90,941,763 R496* probably null Het
Mtdh A G 15: 34,123,719 D364G possibly damaging Het
Mtmr11 C A 3: 96,170,428 L580I probably damaging Het
Muc16 T C 9: 18,640,697 I4767V probably benign Het
Myot A G 18: 44,354,184 T363A probably benign Het
Nfxl1 G A 5: 72,524,215 P658S probably damaging Het
Nhlrc3 A C 3: 53,461,659 S120A probably benign Het
Nmur2 C A 11: 56,040,335 Q183H probably benign Het
Nucb2 T A 7: 116,521,970 I45K probably benign Het
Nup155 A T 15: 8,119,179 D277V probably damaging Het
Olfr995 T C 2: 85,438,397 T254A probably benign Het
Orc1 T G 4: 108,603,371 probably null Het
Panx2 A G 15: 89,068,733 T468A possibly damaging Het
Pcdh7 A G 5: 57,719,810 S236G probably benign Het
Pcdhga2 G C 18: 37,670,857 G585R probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr T G 9: 8,903,742 M588R probably benign Het
Ptpn18 A T 1: 34,469,905 probably null Het
Rbm8a2 T A 1: 175,978,641 H90L probably benign Het
Ryr3 A T 2: 112,646,950 L4507Q possibly damaging Het
Serpina12 A G 12: 104,038,265 V36A probably benign Het
Sis T A 3: 72,937,251 S717C probably damaging Het
Slit2 A G 5: 48,247,185 E846G possibly damaging Het
Smr3a C T 5: 88,008,227 H85Y unknown Het
Sned1 G C 1: 93,274,082 R590P probably benign Het
Sult2a7 A G 7: 14,465,209 Y298H probably damaging Het
Syn3 A G 10: 86,064,929 V365A possibly damaging Het
Syne1 A T 10: 5,227,956 Y4839* probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tbl3 G T 17: 24,702,484 H478N probably damaging Het
Tcirg1 A T 19: 3,899,104 I395N probably damaging Het
Ticrr T C 7: 79,669,485 I406T probably benign Het
Tmem120a C A 5: 135,737,198 K123N probably benign Het
Tmem173 A G 18: 35,734,573 S357P probably damaging Het
Tmem184c A G 8: 77,597,811 V350A probably damaging Het
Tmem70 G T 1: 16,677,044 M128I probably benign Het
Tmx3 A T 18: 90,527,874 probably null Het
Topors G C 4: 40,260,356 S976W unknown Het
Trp53 T C 11: 69,590,693 L341P probably damaging Het
Usp14 T C 18: 10,000,563 K366E possibly damaging Het
Zbtb49 G T 5: 38,213,930 C202* probably null Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Loxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Loxl1 APN 9 58294422 missense possibly damaging 0.89
IGL02549:Loxl1 APN 9 58293638 missense probably damaging 1.00
IGL02562:Loxl1 APN 9 58288916 missense probably damaging 1.00
IGL03062:Loxl1 APN 9 58311910 missense possibly damaging 0.61
R0141:Loxl1 UTSW 9 58312132 missense probably damaging 0.98
R1503:Loxl1 UTSW 9 58293640 missense probably damaging 1.00
R1898:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R2125:Loxl1 UTSW 9 58293712 missense probably damaging 1.00
R2264:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R4094:Loxl1 UTSW 9 58312456 missense probably damaging 0.98
R4993:Loxl1 UTSW 9 58312537 missense probably damaging 0.99
R5484:Loxl1 UTSW 9 58290782 missense possibly damaging 0.75
R5598:Loxl1 UTSW 9 58312367 missense possibly damaging 0.71
R5808:Loxl1 UTSW 9 58294449 missense probably damaging 0.99
R5917:Loxl1 UTSW 9 58312723 missense probably damaging 1.00
R7566:Loxl1 UTSW 9 58312198 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGACTCAGCCCCAAAGTGC -3'
(R):5'- TGATGCTTTCCTGGACCAC -3'

Sequencing Primer
(F):5'- CCCCAAAGTGCAGGAGTCTTAG -3'
(R):5'- GCTTTCCTGGACCACAGCTG -3'
Posted On2019-12-20