Incidental Mutation 'R7899:Caps2'
ID609902
Institutional Source Beutler Lab
Gene Symbol Caps2
Ensembl Gene ENSMUSG00000035694
Gene Namecalcyphosphine 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7899 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location112163621-112216555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112165761 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 19 (S19Y)
Ref Sequence ENSEMBL: ENSMUSP00000129887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092176] [ENSMUST00000170013]
Predicted Effect probably benign
Transcript: ENSMUST00000092176
SMART Domains Protein: ENSMUSP00000089815
Gene: ENSMUSG00000035694

DomainStartEndE-ValueType
Pfam:EF-hand_6 384 420 2e-4 PFAM
Blast:EFh 457 485 5e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000170013
AA Change: S19Y

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129887
Gene: ENSMUSG00000035694
AA Change: S19Y

DomainStartEndE-ValueType
PDB:3E3R|B 403 592 4e-27 PDB
Blast:EFh 425 453 1e-7 BLAST
SCOP:d1hqva_ 430 522 4e-10 SMART
Blast:EFh 461 491 3e-6 BLAST
Blast:EFh 499 527 6e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcyphosine-2 is a calcium-binding protein with 2 EF-hand motifs (Wang et al., 2002 [PubMed 11846421]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,809,320 T49A possibly damaging Het
4932415D10Rik A G 10: 82,282,897 S4760P unknown Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Aagab T C 9: 63,616,850 F80L probably benign Het
Aox2 A G 1: 58,281,237 probably null Het
Arhgef2 T C 3: 88,621,262 S2P probably damaging Het
Bcar3 T G 3: 122,508,253 V199G probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1a G A 8: 84,594,173 V1587M possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cobll1 A G 2: 65,125,931 C328R probably damaging Het
Colec11 A C 12: 28,595,282 V130G probably damaging Het
Dennd5b A T 6: 149,041,661 D572E probably damaging Het
Dido1 A T 2: 180,671,597 S961T possibly damaging Het
Dnah7c A T 1: 46,514,701 M380L probably benign Het
Dnaic2 T C 11: 114,738,630 I161T probably benign Het
Dnttip2 T A 3: 122,282,369 M650K probably damaging Het
Dpp6 C T 5: 27,721,079 P717L probably benign Het
Epha10 A G 4: 124,914,835 E759G Het
Frmd4a T C 2: 4,604,089 W923R probably damaging Het
Ftsj3 C A 11: 106,252,289 E400* probably null Het
Gabra4 C A 5: 71,657,995 probably benign Het
Gfm1 T A 3: 67,473,527 N658K probably benign Het
Gm21560 A T 14: 6,218,220 I86N probably damaging Het
Gm6657 A G 12: 78,197,422 N50D Het
Gm9573 TCAGGGTGGGGGTAGAGCCTGAGCCACTGCTAGATGCAGTGGTGGGCAGGGTGGGGGTAGAGCCTGAG TCAGGGTGGGGGTAGAGCCTGAG 17: 35,620,601 probably benign Het
Gpr68 C A 12: 100,878,448 C279F probably damaging Het
Hspg2 G A 4: 137,548,116 A2752T possibly damaging Het
Hydin A T 8: 110,587,748 D4288V probably benign Het
Ift74 A G 4: 94,621,977 T82A possibly damaging Het
Ints7 T A 1: 191,621,315 W918R probably damaging Het
Kcnc1 T A 7: 46,427,821 I349N probably damaging Het
Loxl1 C T 9: 58,290,834 D580N probably damaging Het
Mlph A T 1: 90,941,763 R496* probably null Het
Mtdh A G 15: 34,123,719 D364G possibly damaging Het
Mtmr11 C A 3: 96,170,428 L580I probably damaging Het
Muc16 T C 9: 18,640,697 I4767V probably benign Het
Myot A G 18: 44,354,184 T363A probably benign Het
Nfxl1 G A 5: 72,524,215 P658S probably damaging Het
Nhlrc3 A C 3: 53,461,659 S120A probably benign Het
Nmur2 C A 11: 56,040,335 Q183H probably benign Het
Nucb2 T A 7: 116,521,970 I45K probably benign Het
Nup155 A T 15: 8,119,179 D277V probably damaging Het
Olfr995 T C 2: 85,438,397 T254A probably benign Het
Orc1 T G 4: 108,603,371 probably null Het
Panx2 A G 15: 89,068,733 T468A possibly damaging Het
Pcdh7 A G 5: 57,719,810 S236G probably benign Het
Pcdhga2 G C 18: 37,670,857 G585R probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr T G 9: 8,903,742 M588R probably benign Het
Ptpn18 A T 1: 34,469,905 probably null Het
Rbm8a2 T A 1: 175,978,641 H90L probably benign Het
Ryr3 A T 2: 112,646,950 L4507Q possibly damaging Het
Serpina12 A G 12: 104,038,265 V36A probably benign Het
Sis T A 3: 72,937,251 S717C probably damaging Het
Slit2 A G 5: 48,247,185 E846G possibly damaging Het
Smr3a C T 5: 88,008,227 H85Y unknown Het
Sned1 G C 1: 93,274,082 R590P probably benign Het
Sult2a7 A G 7: 14,465,209 Y298H probably damaging Het
Syn3 A G 10: 86,064,929 V365A possibly damaging Het
Syne1 A T 10: 5,227,956 Y4839* probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tbl3 G T 17: 24,702,484 H478N probably damaging Het
Tcirg1 A T 19: 3,899,104 I395N probably damaging Het
Ticrr T C 7: 79,669,485 I406T probably benign Het
Tmem120a C A 5: 135,737,198 K123N probably benign Het
Tmem173 A G 18: 35,734,573 S357P probably damaging Het
Tmem184c A G 8: 77,597,811 V350A probably damaging Het
Tmem70 G T 1: 16,677,044 M128I probably benign Het
Tmx3 A T 18: 90,527,874 probably null Het
Topors G C 4: 40,260,356 S976W unknown Het
Trp53 T C 11: 69,590,693 L341P probably damaging Het
Usp14 T C 18: 10,000,563 K366E possibly damaging Het
Zbtb49 G T 5: 38,213,930 C202* probably null Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Caps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Caps2 APN 10 112183060 missense probably damaging 1.00
IGL02159:Caps2 APN 10 112204023 missense probably benign 0.25
IGL02412:Caps2 APN 10 112204036 critical splice donor site probably null
IGL03380:Caps2 APN 10 112200696 missense probably benign 0.05
R0601:Caps2 UTSW 10 112195790 missense possibly damaging 0.95
R0658:Caps2 UTSW 10 112204038 splice site probably benign
R0846:Caps2 UTSW 10 112215585 missense probably damaging 1.00
R1472:Caps2 UTSW 10 112179472 missense probably benign 0.26
R1711:Caps2 UTSW 10 112190978 missense possibly damaging 0.86
R1834:Caps2 UTSW 10 112195718 missense possibly damaging 0.89
R1990:Caps2 UTSW 10 112200686 missense probably benign 0.01
R1996:Caps2 UTSW 10 112204003 missense probably damaging 1.00
R2077:Caps2 UTSW 10 112199727 missense possibly damaging 0.71
R3161:Caps2 UTSW 10 112182486 nonsense probably null
R3162:Caps2 UTSW 10 112182486 nonsense probably null
R3162:Caps2 UTSW 10 112182486 nonsense probably null
R3716:Caps2 UTSW 10 112200732 missense probably benign 0.00
R4702:Caps2 UTSW 10 112208347 missense probably damaging 1.00
R4978:Caps2 UTSW 10 112182494 missense probably benign 0.04
R5285:Caps2 UTSW 10 112208311 missense probably benign
R5911:Caps2 UTSW 10 112165686 start gained probably benign
R5933:Caps2 UTSW 10 112215446 missense probably benign 0.38
R6368:Caps2 UTSW 10 112194968 nonsense probably null
R6476:Caps2 UTSW 10 112175560 missense possibly damaging 0.66
R7442:Caps2 UTSW 10 112208354 missense probably damaging 0.99
R8130:Caps2 UTSW 10 112182476 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATTTGCACCACCCAAACTTG -3'
(R):5'- CTATCATCAACTTCGGTGGCC -3'

Sequencing Primer
(F):5'- GCACCACCCAAACTTGGTTTTAG -3'
(R):5'- GTGGCCCCACACTTACAAAG -3'
Posted On2019-12-20