Incidental Mutation 'R7900:Cnst'
ID609926
Institutional Source Beutler Lab
Gene Symbol Cnst
Ensembl Gene ENSMUSG00000038949
Gene Nameconsortin, connexin sorting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7900 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179546370-179627478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 179622888 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 639 (D639G)
Ref Sequence ENSEMBL: ENSMUSP00000048205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040706]
Predicted Effect probably damaging
Transcript: ENSMUST00000040706
AA Change: D639G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: D639G

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamtsl5 A G 10: 80,341,901 F309S probably damaging Het
Ankle1 C T 8: 71,407,417 T213I probably damaging Het
C4b A G 17: 34,739,777 S528P probably benign Het
Camk2a A G 18: 60,957,366 Y222C probably damaging Het
Ctbp2 A C 7: 133,014,599 S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 L798F probably damaging Het
Cyp11a1 T A 9: 58,016,384 V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 probably null Het
Dlst G T 12: 85,130,518 R346L probably benign Het
Dnah2 A G 11: 69,518,428 S375P probably damaging Het
Dnm3 T A 1: 162,355,371 Y125F probably benign Het
Dock9 C T 14: 121,546,079 A2011T possibly damaging Het
Efr3a T A 15: 65,848,135 probably null Het
Egln1 A T 8: 124,914,140 I319N possibly damaging Het
Gata3 T A 2: 9,858,650 N351I probably damaging Het
Gjc1 T C 11: 102,800,094 N361S probably benign Het
Gpcpd1 T C 2: 132,534,739 T546A probably damaging Het
Gpihbp1 T C 15: 75,597,942 F169L probably benign Het
Gpnmb A T 6: 49,050,466 I375L possibly damaging Het
Itpka A T 2: 119,750,513 T381S probably benign Het
Lhx4 T C 1: 155,741,963 probably benign Het
Lrguk T C 6: 34,129,194 L718P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nr1d1 T A 11: 98,769,711 T477S probably benign Het
Nxnl1 A T 8: 71,566,526 D18E probably damaging Het
Olfr1434 T A 19: 12,283,341 C98S probably damaging Het
Olfr620 T C 7: 103,611,693 Y220C possibly damaging Het
Onecut2 G T 18: 64,341,587 R403L probably damaging Het
Pla2r1 T C 2: 60,428,514 T1177A possibly damaging Het
Prkd2 T C 7: 16,853,344 V405A probably benign Het
Ranbp1 T C 16: 18,245,297 T72A probably damaging Het
Retnla A C 16: 48,843,614 R90S probably benign Het
Sec31b A T 19: 44,526,230 I385N probably damaging Het
Slc6a19 C T 13: 73,700,464 R57H probably damaging Het
Smurf1 T C 5: 144,899,373 D110G probably damaging Het
Specc1 A G 11: 62,219,361 Y975C probably damaging Het
Tas2r136 T A 6: 132,777,636 N176I possibly damaging Het
Tecrl A C 5: 83,279,341 V320G probably benign Het
Tmem245 A G 4: 56,924,973 probably null Het
Tpd52l1 T A 10: 31,338,182 probably null Het
Trbv2 A G 6: 41,047,974 Y108C probably damaging Het
Trpm7 T C 2: 126,797,498 M1689V probably benign Het
Usp24 A G 4: 106,409,400 Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 S721R possibly damaging Het
Vwf G A 6: 125,628,476 probably null Het
Washc4 T A 10: 83,573,773 probably null Het
Yeats4 G A 10: 117,220,559 H71Y possibly damaging Het
Zbtb38 A C 9: 96,688,936 L32V probably damaging Het
Zfy1 T C Y: 725,519 T749A possibly damaging Het
Other mutations in Cnst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Cnst APN 1 179624992 splice site probably benign
R0360:Cnst UTSW 1 179579535 missense probably benign 0.00
R1391:Cnst UTSW 1 179579486 missense possibly damaging 0.81
R1743:Cnst UTSW 1 179610392 missense probably benign 0.18
R1909:Cnst UTSW 1 179622791 missense probably damaging 1.00
R3856:Cnst UTSW 1 179579714 missense probably benign 0.02
R4565:Cnst UTSW 1 179604549 missense probably damaging 1.00
R5041:Cnst UTSW 1 179605028 missense probably damaging 0.99
R5072:Cnst UTSW 1 179622886 missense possibly damaging 0.61
R5087:Cnst UTSW 1 179622813 missense possibly damaging 0.82
R5294:Cnst UTSW 1 179610440 missense probably benign 0.03
R5349:Cnst UTSW 1 179622897 missense possibly damaging 0.58
R5394:Cnst UTSW 1 179601736 splice site probably benign
R6020:Cnst UTSW 1 179609875 missense probably benign
R6198:Cnst UTSW 1 179592865 missense probably damaging 1.00
R6669:Cnst UTSW 1 179605073 splice site probably null
R6767:Cnst UTSW 1 179609954 missense possibly damaging 0.92
R7007:Cnst UTSW 1 179610568 missense probably damaging 1.00
R7179:Cnst UTSW 1 179579382 start gained probably benign
R7356:Cnst UTSW 1 179606530 missense probably benign 0.01
R7730:Cnst UTSW 1 179625085 missense probably damaging 1.00
R8073:Cnst UTSW 1 179606437 missense probably benign 0.00
R8194:Cnst UTSW 1 179610194 missense probably benign 0.00
Z1088:Cnst UTSW 1 179579565 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCGATAAGTCCCAGATACG -3'
(R):5'- TCTGGGTTGGTGAGACTACAAAG -3'

Sequencing Primer
(F):5'- GATAAGTCCCAGATACGCCCCAC -3'
(R):5'- GGTGAGACTACAAAGACTATTTTGC -3'
Posted On2019-12-20