Incidental Mutation 'R7900:Tecrl'
ID 609933
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Name trans-2,3-enoyl-CoA reductase-like
Synonyms Srd5a2l2, D330017N19Rik
MMRRC Submission 045952-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7900 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 83425992-83503042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 83427188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 320 (V320G)
Ref Sequence ENSEMBL: ENSMUSP00000062122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
AlphaFold Q8BFZ1
Predicted Effect probably benign
Transcript: ENSMUST00000053543
AA Change: V320G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: V320G

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Adamtsl5 A G 10: 80,177,735 (GRCm39) F309S probably damaging Het
Ankle1 C T 8: 71,860,061 (GRCm39) T213I probably damaging Het
C4b A G 17: 34,958,751 (GRCm39) S528P probably benign Het
Camk2a A G 18: 61,090,438 (GRCm39) Y222C probably damaging Het
Cnst A G 1: 179,450,453 (GRCm39) D639G probably damaging Het
Ctbp2 A C 7: 132,616,328 (GRCm39) S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 (GRCm39) L798F probably damaging Het
Cyp11a1 T A 9: 57,923,667 (GRCm39) V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 (GRCm39) probably null Het
Dlst G T 12: 85,177,292 (GRCm39) R346L probably benign Het
Dnah2 A G 11: 69,409,254 (GRCm39) S375P probably damaging Het
Dnm3 T A 1: 162,182,940 (GRCm39) Y125F probably benign Het
Dock9 C T 14: 121,783,491 (GRCm39) A2011T possibly damaging Het
Efr3a T A 15: 65,719,984 (GRCm39) probably null Het
Egln1 A T 8: 125,640,879 (GRCm39) I319N possibly damaging Het
Gata3 T A 2: 9,863,461 (GRCm39) N351I probably damaging Het
Gjd3 T C 11: 102,690,920 (GRCm39) N361S probably benign Het
Gpcpd1 T C 2: 132,376,659 (GRCm39) T546A probably damaging Het
Gpihbp1 T C 15: 75,469,791 (GRCm39) F169L probably benign Het
Gpnmb A T 6: 49,027,400 (GRCm39) I375L possibly damaging Het
Itpka A T 2: 119,580,994 (GRCm39) T381S probably benign Het
Lhx4 T C 1: 155,617,709 (GRCm39) probably benign Het
Lrguk T C 6: 34,106,129 (GRCm39) L718P probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nr1d1 T A 11: 98,660,537 (GRCm39) T477S probably benign Het
Nxnl1 A T 8: 72,019,170 (GRCm39) D18E probably damaging Het
Onecut2 G T 18: 64,474,658 (GRCm39) R403L probably damaging Het
Or51v14 T C 7: 103,260,900 (GRCm39) Y220C possibly damaging Het
Or5an1 T A 19: 12,260,705 (GRCm39) C98S probably damaging Het
Pla2r1 T C 2: 60,258,858 (GRCm39) T1177A possibly damaging Het
Prkd2 T C 7: 16,587,269 (GRCm39) V405A probably benign Het
Ranbp1 T C 16: 18,063,161 (GRCm39) T72A probably damaging Het
Retnla A C 16: 48,663,977 (GRCm39) R90S probably benign Het
Sec31b A T 19: 44,514,669 (GRCm39) I385N probably damaging Het
Slc6a19 C T 13: 73,848,583 (GRCm39) R57H probably damaging Het
Smurf1 T C 5: 144,836,183 (GRCm39) D110G probably damaging Het
Specc1 A G 11: 62,110,187 (GRCm39) Y975C probably damaging Het
Tas2r136 T A 6: 132,754,599 (GRCm39) N176I possibly damaging Het
Tmem245 A G 4: 56,924,973 (GRCm39) probably null Het
Tpd52l1 T A 10: 31,214,178 (GRCm39) probably null Het
Trbv2 A G 6: 41,024,908 (GRCm39) Y108C probably damaging Het
Trpm7 T C 2: 126,639,418 (GRCm39) M1689V probably benign Het
Usp24 A G 4: 106,266,597 (GRCm39) Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 (GRCm39) S721R possibly damaging Het
Vwf G A 6: 125,605,439 (GRCm39) probably null Het
Washc4 T A 10: 83,409,637 (GRCm39) probably null Het
Yeats4 G A 10: 117,056,464 (GRCm39) H71Y possibly damaging Het
Zbtb38 A C 9: 96,570,989 (GRCm39) L32V probably damaging Het
Zfy1 T C Y: 725,519 (GRCm39) T749A possibly damaging Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83,442,453 (GRCm39) missense probably benign
IGL02067:Tecrl APN 5 83,432,122 (GRCm39) missense probably benign 0.05
IGL02111:Tecrl APN 5 83,502,639 (GRCm39) missense probably damaging 1.00
IGL02391:Tecrl APN 5 83,502,674 (GRCm39) missense probably benign 0.00
IGL02860:Tecrl APN 5 83,502,844 (GRCm39) missense probably benign 0.01
IGL03079:Tecrl APN 5 83,442,447 (GRCm39) missense probably damaging 0.96
IGL03109:Tecrl APN 5 83,457,156 (GRCm39) intron probably benign
gaudenz UTSW 5 83,457,049 (GRCm39) critical splice donor site probably null
Whoopie UTSW 5 83,442,453 (GRCm39) missense probably damaging 1.00
BB004:Tecrl UTSW 5 83,502,666 (GRCm39) missense probably damaging 1.00
BB014:Tecrl UTSW 5 83,502,666 (GRCm39) missense probably damaging 1.00
R0095:Tecrl UTSW 5 83,442,417 (GRCm39) splice site probably benign
R0347:Tecrl UTSW 5 83,442,479 (GRCm39) missense probably damaging 1.00
R0372:Tecrl UTSW 5 83,442,506 (GRCm39) missense probably damaging 1.00
R0403:Tecrl UTSW 5 83,502,605 (GRCm39) splice site probably benign
R0426:Tecrl UTSW 5 83,502,610 (GRCm39) splice site probably benign
R0597:Tecrl UTSW 5 83,502,775 (GRCm39) nonsense probably null
R1607:Tecrl UTSW 5 83,428,355 (GRCm39) splice site probably null
R1771:Tecrl UTSW 5 83,439,134 (GRCm39) missense probably damaging 1.00
R1800:Tecrl UTSW 5 83,427,077 (GRCm39) missense probably damaging 1.00
R1815:Tecrl UTSW 5 83,427,081 (GRCm39) missense probably benign 0.01
R1869:Tecrl UTSW 5 83,502,706 (GRCm39) missense probably benign 0.00
R1870:Tecrl UTSW 5 83,502,706 (GRCm39) missense probably benign 0.00
R4296:Tecrl UTSW 5 83,461,174 (GRCm39) nonsense probably null
R4471:Tecrl UTSW 5 83,461,134 (GRCm39) missense probably benign
R6281:Tecrl UTSW 5 83,442,453 (GRCm39) missense probably damaging 1.00
R6343:Tecrl UTSW 5 83,442,447 (GRCm39) missense probably damaging 0.96
R6866:Tecrl UTSW 5 83,461,161 (GRCm39) missense probably damaging 1.00
R6948:Tecrl UTSW 5 83,457,097 (GRCm39) missense probably benign
R6971:Tecrl UTSW 5 83,502,649 (GRCm39) missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83,502,768 (GRCm39) missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83,427,182 (GRCm39) missense probably damaging 0.99
R7282:Tecrl UTSW 5 83,502,754 (GRCm39) missense probably benign 0.26
R7444:Tecrl UTSW 5 83,502,915 (GRCm39) unclassified probably benign
R7927:Tecrl UTSW 5 83,502,666 (GRCm39) missense probably damaging 1.00
R8246:Tecrl UTSW 5 83,427,156 (GRCm39) missense probably damaging 0.99
R8360:Tecrl UTSW 5 83,448,764 (GRCm39) missense probably damaging 1.00
R8466:Tecrl UTSW 5 83,428,367 (GRCm39) nonsense probably null
R8947:Tecrl UTSW 5 83,461,154 (GRCm39) missense probably benign 0.10
R8949:Tecrl UTSW 5 83,461,154 (GRCm39) missense probably benign 0.10
R9009:Tecrl UTSW 5 83,432,121 (GRCm39) missense probably damaging 0.96
R9115:Tecrl UTSW 5 83,427,906 (GRCm39) missense possibly damaging 0.93
R9182:Tecrl UTSW 5 83,457,049 (GRCm39) critical splice donor site probably null
R9320:Tecrl UTSW 5 83,428,422 (GRCm39) missense possibly damaging 0.67
X0019:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0024:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0034:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0035:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0036:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0037:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0038:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0039:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0040:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0052:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0053:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0054:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0058:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0060:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0061:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0062:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
X0063:Tecrl UTSW 5 83,486,099 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TAGGTAATCACTTCCTAAGCCTTTT -3'
(R):5'- AGAGGAATATTGTTCACCTGAGTG -3'

Sequencing Primer
(F):5'- AATCACTTCCTAAGCCTTTTTGAGTG -3'
(R):5'- TTTTAAGCCATAGATAAAAGGGCC -3'
Posted On 2019-12-20