Incidental Mutation 'R7900:Lrguk'
ID 609935
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 045952-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7900 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34106129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 718 (L718P)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: L718P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: L718P

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Adamtsl5 A G 10: 80,177,735 (GRCm39) F309S probably damaging Het
Ankle1 C T 8: 71,860,061 (GRCm39) T213I probably damaging Het
C4b A G 17: 34,958,751 (GRCm39) S528P probably benign Het
Camk2a A G 18: 61,090,438 (GRCm39) Y222C probably damaging Het
Cnst A G 1: 179,450,453 (GRCm39) D639G probably damaging Het
Ctbp2 A C 7: 132,616,328 (GRCm39) S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 (GRCm39) L798F probably damaging Het
Cyp11a1 T A 9: 57,923,667 (GRCm39) V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 (GRCm39) probably null Het
Dlst G T 12: 85,177,292 (GRCm39) R346L probably benign Het
Dnah2 A G 11: 69,409,254 (GRCm39) S375P probably damaging Het
Dnm3 T A 1: 162,182,940 (GRCm39) Y125F probably benign Het
Dock9 C T 14: 121,783,491 (GRCm39) A2011T possibly damaging Het
Efr3a T A 15: 65,719,984 (GRCm39) probably null Het
Egln1 A T 8: 125,640,879 (GRCm39) I319N possibly damaging Het
Gata3 T A 2: 9,863,461 (GRCm39) N351I probably damaging Het
Gjd3 T C 11: 102,690,920 (GRCm39) N361S probably benign Het
Gpcpd1 T C 2: 132,376,659 (GRCm39) T546A probably damaging Het
Gpihbp1 T C 15: 75,469,791 (GRCm39) F169L probably benign Het
Gpnmb A T 6: 49,027,400 (GRCm39) I375L possibly damaging Het
Itpka A T 2: 119,580,994 (GRCm39) T381S probably benign Het
Lhx4 T C 1: 155,617,709 (GRCm39) probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nr1d1 T A 11: 98,660,537 (GRCm39) T477S probably benign Het
Nxnl1 A T 8: 72,019,170 (GRCm39) D18E probably damaging Het
Onecut2 G T 18: 64,474,658 (GRCm39) R403L probably damaging Het
Or51v14 T C 7: 103,260,900 (GRCm39) Y220C possibly damaging Het
Or5an1 T A 19: 12,260,705 (GRCm39) C98S probably damaging Het
Pla2r1 T C 2: 60,258,858 (GRCm39) T1177A possibly damaging Het
Prkd2 T C 7: 16,587,269 (GRCm39) V405A probably benign Het
Ranbp1 T C 16: 18,063,161 (GRCm39) T72A probably damaging Het
Retnla A C 16: 48,663,977 (GRCm39) R90S probably benign Het
Sec31b A T 19: 44,514,669 (GRCm39) I385N probably damaging Het
Slc6a19 C T 13: 73,848,583 (GRCm39) R57H probably damaging Het
Smurf1 T C 5: 144,836,183 (GRCm39) D110G probably damaging Het
Specc1 A G 11: 62,110,187 (GRCm39) Y975C probably damaging Het
Tas2r136 T A 6: 132,754,599 (GRCm39) N176I possibly damaging Het
Tecrl A C 5: 83,427,188 (GRCm39) V320G probably benign Het
Tmem245 A G 4: 56,924,973 (GRCm39) probably null Het
Tpd52l1 T A 10: 31,214,178 (GRCm39) probably null Het
Trbv2 A G 6: 41,024,908 (GRCm39) Y108C probably damaging Het
Trpm7 T C 2: 126,639,418 (GRCm39) M1689V probably benign Het
Usp24 A G 4: 106,266,597 (GRCm39) Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 (GRCm39) S721R possibly damaging Het
Vwf G A 6: 125,605,439 (GRCm39) probably null Het
Washc4 T A 10: 83,409,637 (GRCm39) probably null Het
Yeats4 G A 10: 117,056,464 (GRCm39) H71Y possibly damaging Het
Zbtb38 A C 9: 96,570,989 (GRCm39) L32V probably damaging Het
Zfy1 T C Y: 725,519 (GRCm39) T749A possibly damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCCTCAGCATGTGTAGTTCTG -3'
(R):5'- ACATGCTCTCTACAAAGCCTG -3'

Sequencing Primer
(F):5'- CTCAGCATGTGTAGTTCTGTAGAAAC -3'
(R):5'- GCTCCTCACAGATCTTAGTGACAGG -3'
Posted On 2019-12-20