Incidental Mutation 'R7900:Lrguk'
ID 609935
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R7900 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34129194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 718 (L718P)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: L718P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: L718P

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamtsl5 A G 10: 80,341,901 F309S probably damaging Het
Ankle1 C T 8: 71,407,417 T213I probably damaging Het
C4b A G 17: 34,739,777 S528P probably benign Het
Camk2a A G 18: 60,957,366 Y222C probably damaging Het
Cnst A G 1: 179,622,888 D639G probably damaging Het
Ctbp2 A C 7: 133,014,599 S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 L798F probably damaging Het
Cyp11a1 T A 9: 58,016,384 V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 probably null Het
Dlst G T 12: 85,130,518 R346L probably benign Het
Dnah2 A G 11: 69,518,428 S375P probably damaging Het
Dnm3 T A 1: 162,355,371 Y125F probably benign Het
Dock9 C T 14: 121,546,079 A2011T possibly damaging Het
Efr3a T A 15: 65,848,135 probably null Het
Egln1 A T 8: 124,914,140 I319N possibly damaging Het
Gata3 T A 2: 9,858,650 N351I probably damaging Het
Gjc1 T C 11: 102,800,094 N361S probably benign Het
Gpcpd1 T C 2: 132,534,739 T546A probably damaging Het
Gpihbp1 T C 15: 75,597,942 F169L probably benign Het
Gpnmb A T 6: 49,050,466 I375L possibly damaging Het
Itpka A T 2: 119,750,513 T381S probably benign Het
Lhx4 T C 1: 155,741,963 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nr1d1 T A 11: 98,769,711 T477S probably benign Het
Nxnl1 A T 8: 71,566,526 D18E probably damaging Het
Olfr1434 T A 19: 12,283,341 C98S probably damaging Het
Olfr620 T C 7: 103,611,693 Y220C possibly damaging Het
Onecut2 G T 18: 64,341,587 R403L probably damaging Het
Pla2r1 T C 2: 60,428,514 T1177A possibly damaging Het
Prkd2 T C 7: 16,853,344 V405A probably benign Het
Ranbp1 T C 16: 18,245,297 T72A probably damaging Het
Retnla A C 16: 48,843,614 R90S probably benign Het
Sec31b A T 19: 44,526,230 I385N probably damaging Het
Slc6a19 C T 13: 73,700,464 R57H probably damaging Het
Smurf1 T C 5: 144,899,373 D110G probably damaging Het
Specc1 A G 11: 62,219,361 Y975C probably damaging Het
Tas2r136 T A 6: 132,777,636 N176I possibly damaging Het
Tecrl A C 5: 83,279,341 V320G probably benign Het
Tmem245 A G 4: 56,924,973 probably null Het
Tpd52l1 T A 10: 31,338,182 probably null Het
Trbv2 A G 6: 41,047,974 Y108C probably damaging Het
Trpm7 T C 2: 126,797,498 M1689V probably benign Het
Usp24 A G 4: 106,409,400 Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 S721R possibly damaging Het
Vwf G A 6: 125,628,476 probably null Het
Washc4 T A 10: 83,573,773 probably null Het
Yeats4 G A 10: 117,220,559 H71Y possibly damaging Het
Zbtb38 A C 9: 96,688,936 L32V probably damaging Het
Zfy1 T C Y: 725,519 T749A possibly damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCCTCAGCATGTGTAGTTCTG -3'
(R):5'- ACATGCTCTCTACAAAGCCTG -3'

Sequencing Primer
(F):5'- CTCAGCATGTGTAGTTCTGTAGAAAC -3'
(R):5'- GCTCCTCACAGATCTTAGTGACAGG -3'
Posted On 2019-12-20