Incidental Mutation 'R7900:Gjd3'
ID 609955
Institutional Source Beutler Lab
Gene Symbol Gjd3
Ensembl Gene ENSMUSG00000047197
Gene Name gap junction protein, delta 3
Synonyms Gja11, connexin 30.2, cx30.2, connexin-30.2, Gjc1
MMRRC Submission 045952-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.325) question?
Stock # R7900 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98873006-98873842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102690920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 361 (N361S)
Ref Sequence ENSEMBL: ENSMUSP00000066901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068933] [ENSMUST00000092567] [ENSMUST00000107075]
AlphaFold Q91YD1
Predicted Effect probably benign
Transcript: ENSMUST00000068933
AA Change: N361S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000066901
Gene: ENSMUSG00000034520
AA Change: N361S

DomainStartEndE-ValueType
CNX 42 75 1.57e-17 SMART
low complexity region 128 137 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
Connexin_CCC 187 253 3.44e-41 SMART
coiled coil region 333 358 N/A INTRINSIC
low complexity region 368 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092567
AA Change: N361S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000090228
Gene: ENSMUSG00000034520
AA Change: N361S

DomainStartEndE-ValueType
CNX 42 75 1.57e-17 SMART
low complexity region 128 137 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
Connexin_CCC 187 253 3.44e-41 SMART
coiled coil region 333 358 N/A INTRINSIC
low complexity region 368 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107075
AA Change: N361S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102690
Gene: ENSMUSG00000034520
AA Change: N361S

DomainStartEndE-ValueType
CNX 42 75 1.57e-17 SMART
low complexity region 128 137 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
Connexin_CCC 187 253 3.44e-41 SMART
coiled coil region 333 358 N/A INTRINSIC
low complexity region 368 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the large family of connexins that are required for the formation of gap junctions. Six connexin monomers form a hemichannel, or connexon, on the cell surface. This connexon can interact with a connexon from a neighboring cell, thus forming a channel linking the cytoplasm of the 2 cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accelerated atrioventricular nodal conduction velocity in the heart but no significant alterations in excitability or fast network oscillations in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Adamtsl5 A G 10: 80,177,735 (GRCm39) F309S probably damaging Het
Ankle1 C T 8: 71,860,061 (GRCm39) T213I probably damaging Het
C4b A G 17: 34,958,751 (GRCm39) S528P probably benign Het
Camk2a A G 18: 61,090,438 (GRCm39) Y222C probably damaging Het
Cnst A G 1: 179,450,453 (GRCm39) D639G probably damaging Het
Ctbp2 A C 7: 132,616,328 (GRCm39) S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 (GRCm39) L798F probably damaging Het
Cyp11a1 T A 9: 57,923,667 (GRCm39) V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 (GRCm39) probably null Het
Dlst G T 12: 85,177,292 (GRCm39) R346L probably benign Het
Dnah2 A G 11: 69,409,254 (GRCm39) S375P probably damaging Het
Dnm3 T A 1: 162,182,940 (GRCm39) Y125F probably benign Het
Dock9 C T 14: 121,783,491 (GRCm39) A2011T possibly damaging Het
Efr3a T A 15: 65,719,984 (GRCm39) probably null Het
Egln1 A T 8: 125,640,879 (GRCm39) I319N possibly damaging Het
Gata3 T A 2: 9,863,461 (GRCm39) N351I probably damaging Het
Gpcpd1 T C 2: 132,376,659 (GRCm39) T546A probably damaging Het
Gpihbp1 T C 15: 75,469,791 (GRCm39) F169L probably benign Het
Gpnmb A T 6: 49,027,400 (GRCm39) I375L possibly damaging Het
Itpka A T 2: 119,580,994 (GRCm39) T381S probably benign Het
Lhx4 T C 1: 155,617,709 (GRCm39) probably benign Het
Lrguk T C 6: 34,106,129 (GRCm39) L718P probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nr1d1 T A 11: 98,660,537 (GRCm39) T477S probably benign Het
Nxnl1 A T 8: 72,019,170 (GRCm39) D18E probably damaging Het
Onecut2 G T 18: 64,474,658 (GRCm39) R403L probably damaging Het
Or51v14 T C 7: 103,260,900 (GRCm39) Y220C possibly damaging Het
Or5an1 T A 19: 12,260,705 (GRCm39) C98S probably damaging Het
Pla2r1 T C 2: 60,258,858 (GRCm39) T1177A possibly damaging Het
Prkd2 T C 7: 16,587,269 (GRCm39) V405A probably benign Het
Ranbp1 T C 16: 18,063,161 (GRCm39) T72A probably damaging Het
Retnla A C 16: 48,663,977 (GRCm39) R90S probably benign Het
Sec31b A T 19: 44,514,669 (GRCm39) I385N probably damaging Het
Slc6a19 C T 13: 73,848,583 (GRCm39) R57H probably damaging Het
Smurf1 T C 5: 144,836,183 (GRCm39) D110G probably damaging Het
Specc1 A G 11: 62,110,187 (GRCm39) Y975C probably damaging Het
Tas2r136 T A 6: 132,754,599 (GRCm39) N176I possibly damaging Het
Tecrl A C 5: 83,427,188 (GRCm39) V320G probably benign Het
Tmem245 A G 4: 56,924,973 (GRCm39) probably null Het
Tpd52l1 T A 10: 31,214,178 (GRCm39) probably null Het
Trbv2 A G 6: 41,024,908 (GRCm39) Y108C probably damaging Het
Trpm7 T C 2: 126,639,418 (GRCm39) M1689V probably benign Het
Usp24 A G 4: 106,266,597 (GRCm39) Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 (GRCm39) S721R possibly damaging Het
Vwf G A 6: 125,605,439 (GRCm39) probably null Het
Washc4 T A 10: 83,409,637 (GRCm39) probably null Het
Yeats4 G A 10: 117,056,464 (GRCm39) H71Y possibly damaging Het
Zbtb38 A C 9: 96,570,989 (GRCm39) L32V probably damaging Het
Zfy1 T C Y: 725,519 (GRCm39) T749A possibly damaging Het
Other mutations in Gjd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Gjd3 APN 11 102,691,552 (GRCm39) missense probably benign 0.16
IGL02083:Gjd3 APN 11 98,873,587 (GRCm39) missense probably damaging 1.00
IGL03164:Gjd3 APN 11 102,691,547 (GRCm39) missense possibly damaging 0.81
IGL03396:Gjd3 APN 11 102,691,353 (GRCm39) missense probably benign 0.00
PIT4812001:Gjd3 UTSW 11 102,691,807 (GRCm39) nonsense probably null
R0683:Gjd3 UTSW 11 102,691,237 (GRCm39) missense probably benign 0.00
R1642:Gjd3 UTSW 11 98,873,535 (GRCm39) missense probably benign 0.01
R1712:Gjd3 UTSW 11 102,691,706 (GRCm39) missense possibly damaging 0.96
R2267:Gjd3 UTSW 11 98,873,227 (GRCm39) missense probably damaging 0.98
R3853:Gjd3 UTSW 11 102,690,952 (GRCm39) missense probably benign 0.10
R4397:Gjd3 UTSW 11 98,873,247 (GRCm39) missense probably damaging 1.00
R4948:Gjd3 UTSW 11 102,691,247 (GRCm39) missense probably damaging 1.00
R5564:Gjd3 UTSW 11 102,691,029 (GRCm39) missense probably benign 0.04
R5811:Gjd3 UTSW 11 98,873,226 (GRCm39) missense possibly damaging 0.94
R6577:Gjd3 UTSW 11 102,691,130 (GRCm39) missense possibly damaging 0.69
R6939:Gjd3 UTSW 11 102,691,733 (GRCm39) missense probably damaging 0.98
R7263:Gjd3 UTSW 11 102,690,963 (GRCm39) missense possibly damaging 0.69
R7352:Gjd3 UTSW 11 102,691,278 (GRCm39) missense probably damaging 1.00
R7578:Gjd3 UTSW 11 98,873,301 (GRCm39) missense probably damaging 0.99
R7657:Gjd3 UTSW 11 98,873,586 (GRCm39) nonsense probably null
R8187:Gjd3 UTSW 11 102,691,381 (GRCm39) nonsense probably null
R8544:Gjd3 UTSW 11 98,873,488 (GRCm39) nonsense probably null
R8704:Gjd3 UTSW 11 98,873,445 (GRCm39) missense probably damaging 1.00
R8778:Gjd3 UTSW 11 98,873,842 (GRCm39) start codon destroyed probably null 0.99
R8883:Gjd3 UTSW 11 102,691,769 (GRCm39) missense probably damaging 0.98
R8924:Gjd3 UTSW 11 98,873,325 (GRCm39) missense probably damaging 1.00
Z1176:Gjd3 UTSW 11 102,690,834 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCATCCCTGAAGATAACCAGAG -3'
(R):5'- TACACTGAGCTGTCCAATGC -3'

Sequencing Primer
(F):5'- CCAGAGCCAAATGTTTACTCAATGG -3'
(R):5'- GAGCTGTCCAATGCTAAGATTGCC -3'
Posted On 2019-12-20