Incidental Mutation 'R7900:Ranbp1'
ID609961
Institutional Source Beutler Lab
Gene Symbol Ranbp1
Ensembl Gene ENSMUSG00000005732
Gene NameRAN binding protein 1
SynonymsHtf9a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7900 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18239784-18248732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18245297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 72 (T72A)
Ref Sequence ENSEMBL: ENSMUSP00000111309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052325] [ENSMUST00000100099] [ENSMUST00000115640] [ENSMUST00000115645] [ENSMUST00000140206] [ENSMUST00000231509]
Predicted Effect probably damaging
Transcript: ENSMUST00000052325
AA Change: T22A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055288
Gene: ENSMUSG00000005732
AA Change: T22A

DomainStartEndE-ValueType
RanBD 1 108 4.92e-46 SMART
coiled coil region 123 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100099
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115640
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115645
AA Change: T72A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111309
Gene: ENSMUSG00000005732
AA Change: T72A

DomainStartEndE-ValueType
RanBD 27 158 3.33e-75 SMART
low complexity region 183 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140206
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145112
SMART Domains Protein: ENSMUSP00000117026
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
Pfam:PCMT 118 220 4.2e-7 PFAM
Pfam:tRNA_U5-meth_tr 118 280 4e-16 PFAM
Pfam:MTS 129 229 5.4e-6 PFAM
Pfam:Cons_hypoth95 143 277 6.5e-5 PFAM
Pfam:PrmA 146 234 2e-4 PFAM
Pfam:Ubie_methyltran 148 223 1e-4 PFAM
Pfam:Methyltransf_31 158 271 6.1e-14 PFAM
Pfam:Methyltransf_18 160 263 8.3e-11 PFAM
Pfam:Methyltransf_4 161 237 7.1e-5 PFAM
Pfam:Methyltransf_26 161 274 2e-6 PFAM
Pfam:Methyltransf_25 164 251 5.2e-7 PFAM
Pfam:Methyltransf_11 165 227 9.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231509
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Meta Mutation Damage Score 0.6085 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal growth retardation, decreased body weight, impaired spermatogenesis, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamtsl5 A G 10: 80,341,901 F309S probably damaging Het
Ankle1 C T 8: 71,407,417 T213I probably damaging Het
C4b A G 17: 34,739,777 S528P probably benign Het
Camk2a A G 18: 60,957,366 Y222C probably damaging Het
Cnst A G 1: 179,622,888 D639G probably damaging Het
Ctbp2 A C 7: 133,014,599 S202R probably benign Het
Cwf19l2 G T 9: 3,460,107 L798F probably damaging Het
Cyp11a1 T A 9: 58,016,384 V124E possibly damaging Het
Ddx3y C T Y: 1,266,594 probably null Het
Dlst G T 12: 85,130,518 R346L probably benign Het
Dnah2 A G 11: 69,518,428 S375P probably damaging Het
Dnm3 T A 1: 162,355,371 Y125F probably benign Het
Dock9 C T 14: 121,546,079 A2011T possibly damaging Het
Efr3a T A 15: 65,848,135 probably null Het
Egln1 A T 8: 124,914,140 I319N possibly damaging Het
Gata3 T A 2: 9,858,650 N351I probably damaging Het
Gjc1 T C 11: 102,800,094 N361S probably benign Het
Gpcpd1 T C 2: 132,534,739 T546A probably damaging Het
Gpihbp1 T C 15: 75,597,942 F169L probably benign Het
Gpnmb A T 6: 49,050,466 I375L possibly damaging Het
Itpka A T 2: 119,750,513 T381S probably benign Het
Lhx4 T C 1: 155,741,963 probably benign Het
Lrguk T C 6: 34,129,194 L718P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nr1d1 T A 11: 98,769,711 T477S probably benign Het
Nxnl1 A T 8: 71,566,526 D18E probably damaging Het
Olfr1434 T A 19: 12,283,341 C98S probably damaging Het
Olfr620 T C 7: 103,611,693 Y220C possibly damaging Het
Onecut2 G T 18: 64,341,587 R403L probably damaging Het
Pla2r1 T C 2: 60,428,514 T1177A possibly damaging Het
Prkd2 T C 7: 16,853,344 V405A probably benign Het
Retnla A C 16: 48,843,614 R90S probably benign Het
Sec31b A T 19: 44,526,230 I385N probably damaging Het
Slc6a19 C T 13: 73,700,464 R57H probably damaging Het
Smurf1 T C 5: 144,899,373 D110G probably damaging Het
Specc1 A G 11: 62,219,361 Y975C probably damaging Het
Tas2r136 T A 6: 132,777,636 N176I possibly damaging Het
Tecrl A C 5: 83,279,341 V320G probably benign Het
Tmem245 A G 4: 56,924,973 probably null Het
Tpd52l1 T A 10: 31,338,182 probably null Het
Trbv2 A G 6: 41,047,974 Y108C probably damaging Het
Trpm7 T C 2: 126,797,498 M1689V probably benign Het
Usp24 A G 4: 106,409,400 Y1855C probably damaging Het
Usp9y A T Y: 1,384,354 S721R possibly damaging Het
Vwf G A 6: 125,628,476 probably null Het
Washc4 T A 10: 83,573,773 probably null Het
Yeats4 G A 10: 117,220,559 H71Y possibly damaging Het
Zbtb38 A C 9: 96,688,936 L32V probably damaging Het
Zfy1 T C Y: 725,519 T749A possibly damaging Het
Other mutations in Ranbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Ranbp1 APN 16 18247281 unclassified probably benign
R0189:Ranbp1 UTSW 16 18241743 critical splice donor site probably null
R0764:Ranbp1 UTSW 16 18240158 nonsense probably null
R3276:Ranbp1 UTSW 16 18247429 unclassified probably benign
R4381:Ranbp1 UTSW 16 18247344 missense probably damaging 1.00
R4620:Ranbp1 UTSW 16 18240104 unclassified probably benign
R5127:Ranbp1 UTSW 16 18247287 critical splice donor site probably null
R5655:Ranbp1 UTSW 16 18241805 missense probably damaging 1.00
R5965:Ranbp1 UTSW 16 18245228 missense probably damaging 0.97
R7080:Ranbp1 UTSW 16 18245233 missense possibly damaging 0.51
R8356:Ranbp1 UTSW 16 18245306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACAGCCTAAATTCACTG -3'
(R):5'- CACTTTGTGGCAATTGGTCCAG -3'

Sequencing Primer
(F):5'- TCACTGTCATAGTTCAGAGACTTG -3'
(R):5'- GTCCAGGTGTGAGTTCCCTC -3'
Posted On2019-12-20