Mutagenetix > Incidental Mutation

Incidental Mutation 'R7901:Atp6v0a2'

609980

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

045953-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R7901 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 124641547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 200 (T200I)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: T200I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: T200I

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197931

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200292

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,269,706	E3126G	unknown	Het
Ablim1	A	T	19: 57,131,002		probably null	Het
Adpgk	T	C	9: 59,315,017	V409A	probably benign	Het
Agfg2	A	T	5: 137,667,704	F98I	probably damaging	Het
Arhgap17	A	T	7: 123,286,568		probably benign	Het
Asb8	T	C	15: 98,142,733	Y16C	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Ccnt1	A	T	15: 98,543,916	D490E	probably benign	Het
Cenpf	G	T	1: 189,657,248	D1462E	probably damaging	Het
Clcn6	C	T	4: 148,010,745	R736H	probably damaging	Het
Col4a2	A	T	8: 11,429,358	D747V	probably benign	Het
Crybg3	T	C	16: 59,557,544	T1116A	probably damaging	Het
Csf1r	T	A	18: 61,110,296	L128Q	probably damaging	Het
Ddx17	A	T	15: 79,538,588	D316E	probably damaging	Het
Ect2l	T	A	10: 18,141,964	D681V	possibly damaging	Het
Ell2	A	T	13: 75,763,986	K464*	probably null	Het
Eme1	G	T	11: 94,650,819	P59Q	probably damaging	Het
Etl4	T	C	2: 20,290,010	S2P	possibly damaging	Het
Fndc9	T	C	11: 46,237,749	Y32H	probably damaging	Het
Frem1	G	T	4: 82,959,377	T1321K	probably benign	Het
Gabrg2	A	G	11: 41,976,591	V67A	probably benign	Het
Gm4553	ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG	ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG	7: 142,164,865		probably benign	Het
Gm5145	A	C	17: 20,570,638	I93L	possibly damaging	Het
Gpld1	T	A	13: 24,962,775	V240E	probably damaging	Het
Gsc	T	A	12: 104,472,872	S82C	possibly damaging	Het
H2-T10	C	T	17: 36,120,251	E173K	probably benign	Het
Ifi213	A	T	1: 173,567,218	S584T	probably benign	Het
Klk1b1	T	C	7: 43,971,245	I253T	probably damaging	Het
Klra4	A	G	6: 130,063,150	L53P	probably damaging	Het
Lct	A	G	1: 128,288,985	Y1697H	probably benign	Het
Mrs2	T	A	13: 25,018,566	D64V	possibly damaging	Het
Muc13	A	G	16: 33,815,841	Q565R	probably damaging	Het
Nlrp6	T	C	7: 140,927,440	V873A	possibly damaging	Het
Nup155	C	T	15: 8,116,442	P159L	possibly damaging	Het
Olfr1420	A	T	19: 11,896,534	H171L	probably benign	Het
Olfr575	T	C	7: 102,955,680		probably null	Het
Olfr734	A	T	14: 50,320,116	S240T	probably damaging	Het
Phip	T	G	9: 82,890,150	M1115L	probably benign	Het
Ppip5k1	T	C	2: 121,311,909	Q1353R	probably damaging	Het
Ptprb	C	G	10: 116,369,428	P1896A	probably benign	Het
Rgl2	T	C	17: 33,935,825	L601P	possibly damaging	Het
Sash1	C	T	10: 8,780,564	W221*	probably null	Het
Skint1	A	C	4: 112,019,202	T107P	probably damaging	Het
Slc45a4	G	A	15: 73,605,772		probably benign	Het
Snx13	T	A	12: 35,100,625	D309E	probably benign	Het
Spcs1	A	G	14: 31,000,671	Y64H	probably benign	Het
Tep1	A	T	14: 50,826,851	Y2434N	possibly damaging	Het
Tnpo3	T	C	6: 29,568,991	E454G	possibly damaging	Het
Tsg101	G	T	7: 46,913,435	Q24K	probably benign	Het
Ttc6	C	T	12: 57,688,567	R1132W	probably damaging	Het
Unkl	T	C	17: 25,218,653	S200P	probably damaging	Het
Uts2r	G	A	11: 121,161,408	S366N	probably benign	Het
Wbp4	A	T	14: 79,472,405	V130E	probably damaging	Het
Zfp592	T	G	7: 81,024,721	S478A	probably benign	Het
Zfp664	A	T	5: 124,885,775	K78*	probably null	Het
Zfp738	A	T	13: 67,672,991	L79*	probably null	Het
Zfyve28	C	T	5: 34,224,982	R258Q	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCTTTGTCCAGCACACAGG -3'
(R):5'- AACTGTAGGGCTCAATGTAGGG -3'

Sequencing Primer
(F):5'- AGCACACAGGTATCTTGCTG -3'
(R):5'- CTCAATGTAGGGCTCCAGGAG -3'

Posted On

2019-12-20