Incidental Mutation 'R7901:Tnpo3'
ID609983
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Nametransportin 3
SynonymsD6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7901 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29540827-29609887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29568991 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 454 (E454G)
Ref Sequence ENSEMBL: ENSMUSP00000012679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012679
AA Change: E454G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: E454G

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115251
AA Change: E454G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: E454G

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,706 E3126G unknown Het
Ablim1 A T 19: 57,131,002 probably null Het
Adpgk T C 9: 59,315,017 V409A probably benign Het
Agfg2 A T 5: 137,667,704 F98I probably damaging Het
Arhgap17 A T 7: 123,286,568 probably benign Het
Asb8 T C 15: 98,142,733 Y16C probably damaging Het
Atp6v0a2 C T 5: 124,641,547 T200I probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccnt1 A T 15: 98,543,916 D490E probably benign Het
Cenpf G T 1: 189,657,248 D1462E probably damaging Het
Clcn6 C T 4: 148,010,745 R736H probably damaging Het
Col4a2 A T 8: 11,429,358 D747V probably benign Het
Crybg3 T C 16: 59,557,544 T1116A probably damaging Het
Csf1r T A 18: 61,110,296 L128Q probably damaging Het
Ddx17 A T 15: 79,538,588 D316E probably damaging Het
Ect2l T A 10: 18,141,964 D681V possibly damaging Het
Ell2 A T 13: 75,763,986 K464* probably null Het
Eme1 G T 11: 94,650,819 P59Q probably damaging Het
Etl4 T C 2: 20,290,010 S2P possibly damaging Het
Fndc9 T C 11: 46,237,749 Y32H probably damaging Het
Frem1 G T 4: 82,959,377 T1321K probably benign Het
Gabrg2 A G 11: 41,976,591 V67A probably benign Het
Gm4553 ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG 7: 142,164,865 probably benign Het
Gm5145 A C 17: 20,570,638 I93L possibly damaging Het
Gpld1 T A 13: 24,962,775 V240E probably damaging Het
Gsc T A 12: 104,472,872 S82C possibly damaging Het
H2-T10 C T 17: 36,120,251 E173K probably benign Het
Ifi213 A T 1: 173,567,218 S584T probably benign Het
Klk1b1 T C 7: 43,971,245 I253T probably damaging Het
Klra4 A G 6: 130,063,150 L53P probably damaging Het
Lct A G 1: 128,288,985 Y1697H probably benign Het
Mrs2 T A 13: 25,018,566 D64V possibly damaging Het
Muc13 A G 16: 33,815,841 Q565R probably damaging Het
Nlrp6 T C 7: 140,927,440 V873A possibly damaging Het
Nup155 C T 15: 8,116,442 P159L possibly damaging Het
Olfr1420 A T 19: 11,896,534 H171L probably benign Het
Olfr575 T C 7: 102,955,680 probably null Het
Olfr734 A T 14: 50,320,116 S240T probably damaging Het
Phip T G 9: 82,890,150 M1115L probably benign Het
Ppip5k1 T C 2: 121,311,909 Q1353R probably damaging Het
Ptprb C G 10: 116,369,428 P1896A probably benign Het
Rgl2 T C 17: 33,935,825 L601P possibly damaging Het
Sash1 C T 10: 8,780,564 W221* probably null Het
Skint1 A C 4: 112,019,202 T107P probably damaging Het
Slc45a4 G A 15: 73,605,772 probably benign Het
Snx13 T A 12: 35,100,625 D309E probably benign Het
Spcs1 A G 14: 31,000,671 Y64H probably benign Het
Tep1 A T 14: 50,826,851 Y2434N possibly damaging Het
Tsg101 G T 7: 46,913,435 Q24K probably benign Het
Ttc6 C T 12: 57,688,567 R1132W probably damaging Het
Unkl T C 17: 25,218,653 S200P probably damaging Het
Uts2r G A 11: 121,161,408 S366N probably benign Het
Wbp4 A T 14: 79,472,405 V130E probably damaging Het
Zfp592 T G 7: 81,024,721 S478A probably benign Het
Zfp664 A T 5: 124,885,775 K78* probably null Het
Zfp738 A T 13: 67,672,991 L79* probably null Het
Zfyve28 C T 5: 34,224,982 R258Q probably damaging Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0384:Tnpo3 UTSW 6 29582164 critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29565759 missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29560092 missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29562900 nonsense probably null
R7898:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R8003:Tnpo3 UTSW 6 29551901 missense probably benign 0.09
R8144:Tnpo3 UTSW 6 29558762 missense probably benign
R8147:Tnpo3 UTSW 6 29589214 missense probably benign 0.01
R8183:Tnpo3 UTSW 6 29558759 missense probably damaging 0.97
R8297:Tnpo3 UTSW 6 29582303 missense possibly damaging 0.91
R8329:Tnpo3 UTSW 6 29558833 nonsense probably null
R8424:Tnpo3 UTSW 6 29555206 missense probably benign 0.06
R8798:Tnpo3 UTSW 6 29572621 missense not run
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAAGCTGCTCACGATGCAC -3'
(R):5'- AGCACATTCTTAGCACCTCAAG -3'

Sequencing Primer
(F):5'- AACACCGAGGCAGCTCAGTG -3'
(R):5'- TTCTTAGCACCTCAAGAAAACAAG -3'
Posted On2019-12-20