Mutagenetix > Incidental Mutation

Incidental Mutation 'R7901:Nlrp6'

609991

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R7901 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140927440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 873 (V873A)

Ref Sequence

ENSEMBL: ENSMUSP00000139170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106045
AA Change: V856A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: V856A

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000183845
AA Change: V843A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: V843A

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

possibly damaging
Transcript: ENSMUST00000184560
AA Change: V873A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: V873A

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,269,706	E3126G	unknown	Het
Ablim1	A	T	19: 57,131,002		probably null	Het
Adpgk	T	C	9: 59,315,017	V409A	probably benign	Het
Agfg2	A	T	5: 137,667,704	F98I	probably damaging	Het
Arhgap17	A	T	7: 123,286,568		probably benign	Het
Asb8	T	C	15: 98,142,733	Y16C	probably damaging	Het
Atp6v0a2	C	T	5: 124,641,547	T200I	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Ccnt1	A	T	15: 98,543,916	D490E	probably benign	Het
Cenpf	G	T	1: 189,657,248	D1462E	probably damaging	Het
Clcn6	C	T	4: 148,010,745	R736H	probably damaging	Het
Col4a2	A	T	8: 11,429,358	D747V	probably benign	Het
Crybg3	T	C	16: 59,557,544	T1116A	probably damaging	Het
Csf1r	T	A	18: 61,110,296	L128Q	probably damaging	Het
Ddx17	A	T	15: 79,538,588	D316E	probably damaging	Het
Ect2l	T	A	10: 18,141,964	D681V	possibly damaging	Het
Ell2	A	T	13: 75,763,986	K464*	probably null	Het
Eme1	G	T	11: 94,650,819	P59Q	probably damaging	Het
Etl4	T	C	2: 20,290,010	S2P	possibly damaging	Het
Fndc9	T	C	11: 46,237,749	Y32H	probably damaging	Het
Frem1	G	T	4: 82,959,377	T1321K	probably benign	Het
Gabrg2	A	G	11: 41,976,591	V67A	probably benign	Het
Gm4553	ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG	ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG	7: 142,164,865		probably benign	Het
Gm5145	A	C	17: 20,570,638	I93L	possibly damaging	Het
Gpld1	T	A	13: 24,962,775	V240E	probably damaging	Het
Gsc	T	A	12: 104,472,872	S82C	possibly damaging	Het
H2-T10	C	T	17: 36,120,251	E173K	probably benign	Het
Ifi213	A	T	1: 173,567,218	S584T	probably benign	Het
Klk1b1	T	C	7: 43,971,245	I253T	probably damaging	Het
Klra4	A	G	6: 130,063,150	L53P	probably damaging	Het
Lct	A	G	1: 128,288,985	Y1697H	probably benign	Het
Mrs2	T	A	13: 25,018,566	D64V	possibly damaging	Het
Muc13	A	G	16: 33,815,841	Q565R	probably damaging	Het
Nup155	C	T	15: 8,116,442	P159L	possibly damaging	Het
Olfr1420	A	T	19: 11,896,534	H171L	probably benign	Het
Olfr575	T	C	7: 102,955,680		probably null	Het
Olfr734	A	T	14: 50,320,116	S240T	probably damaging	Het
Phip	T	G	9: 82,890,150	M1115L	probably benign	Het
Ppip5k1	T	C	2: 121,311,909	Q1353R	probably damaging	Het
Ptprb	C	G	10: 116,369,428	P1896A	probably benign	Het
Rgl2	T	C	17: 33,935,825	L601P	possibly damaging	Het
Sash1	C	T	10: 8,780,564	W221*	probably null	Het
Skint1	A	C	4: 112,019,202	T107P	probably damaging	Het
Slc45a4	G	A	15: 73,605,772		probably benign	Het
Snx13	T	A	12: 35,100,625	D309E	probably benign	Het
Spcs1	A	G	14: 31,000,671	Y64H	probably benign	Het
Tep1	A	T	14: 50,826,851	Y2434N	possibly damaging	Het
Tnpo3	T	C	6: 29,568,991	E454G	possibly damaging	Het
Tsg101	G	T	7: 46,913,435	Q24K	probably benign	Het
Ttc6	C	T	12: 57,688,567	R1132W	probably damaging	Het
Unkl	T	C	17: 25,218,653	S200P	probably damaging	Het
Uts2r	G	A	11: 121,161,408	S366N	probably benign	Het
Wbp4	A	T	14: 79,472,405	V130E	probably damaging	Het
Zfp592	T	G	7: 81,024,721	S478A	probably benign	Het
Zfp664	A	T	5: 124,885,775	K78*	probably null	Het
Zfp738	A	T	13: 67,672,991	L79*	probably null	Het
Zfyve28	C	T	5: 34,224,982	R258Q	probably damaging	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1587:Nlrp6	UTSW	7	140923046	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4484:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5924:Nlrp6	UTSW	7	140923490	missense	probably damaging	1.00
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6480:Nlrp6	UTSW	7	140927443	missense	possibly damaging	0.93
R6873:Nlrp6	UTSW	7	140923520	missense	probably benign	0.01
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7532:Nlrp6	UTSW	7	140925184	missense	probably benign	0.00
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCAACTGACTGTCTTCTGG -3'
(R):5'- CTTGAAAGACTTGCCTGGAGG -3'

Sequencing Primer
(F):5'- GGTACTTGTCAAATCCTAATCAGAC -3'
(R):5'- AGAAGCTGGCATCTTCTTGC -3'

Posted On

2019-12-20