Incidental Mutation 'R0682:Plekhm2'
ID 61000
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Name pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms 2310034J19Rik
MMRRC Submission 038867-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0682 (G1)
Quality Score 128
Status Not validated
Chromosome 4
Chromosomal Location 141353043-141391457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141355436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 871 (I871V)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000038661] [ENSMUST00000084203]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030751
AA Change: I871V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: I871V

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038661
SMART Domains Protein: ENSMUSP00000039188
Gene: ENSMUSG00000040740

DomainStartEndE-ValueType
Pfam:Mito_carr 16 111 2.2e-14 PFAM
Pfam:Mito_carr 113 213 7.6e-18 PFAM
Pfam:Mito_carr 217 314 9.3e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084203
AA Change: I891V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: I891V

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,121,650 (GRCm39) H83R probably benign Het
Abcd3 A C 3: 121,563,216 (GRCm39) I471S possibly damaging Het
Abcg1 G A 17: 31,330,225 (GRCm39) V509I probably benign Het
Adamts9 A T 6: 92,880,783 (GRCm39) N497K possibly damaging Het
Agap2 A G 10: 126,919,351 (GRCm39) S479G unknown Het
Asic2 T C 11: 80,777,506 (GRCm39) I402V possibly damaging Het
Atp1a2 G A 1: 172,112,164 (GRCm39) T577I probably benign Het
Atraid T A 5: 31,209,612 (GRCm39) I92K probably damaging Het
Dpp10 C A 1: 123,832,852 (GRCm39) A31S probably damaging Het
Erich6 A T 3: 58,544,232 (GRCm39) F118L probably benign Het
Galnt18 T C 7: 111,119,222 (GRCm39) Y418C probably damaging Het
Herc1 T A 9: 66,389,263 (GRCm39) C3927S possibly damaging Het
Ifit2 G A 19: 34,551,012 (GRCm39) R184H probably benign Het
Kif24 A T 4: 41,428,620 (GRCm39) N113K probably benign Het
Lrp1b T A 2: 41,185,653 (GRCm39) Y1354F probably benign Het
Muc1 T A 3: 89,138,439 (GRCm39) I427N probably damaging Het
Muc5ac A G 7: 141,359,406 (GRCm39) T1288A possibly damaging Het
Or7g32 C A 9: 19,388,645 (GRCm39) M300I probably benign Het
Or9i14 C T 19: 13,792,501 (GRCm39) C151Y possibly damaging Het
Pex26 T A 6: 121,161,363 (GRCm39) V47E probably damaging Het
Rasal2 A G 1: 157,006,779 (GRCm39) S111P probably damaging Het
Rnf133 A T 6: 23,649,569 (GRCm39) I163N probably damaging Het
Rrp8 A C 7: 105,383,218 (GRCm39) D349E probably damaging Het
Sdhd G T 9: 50,511,905 (GRCm39) Q38K probably benign Het
Ssh1 C T 5: 114,098,718 (GRCm39) S117N probably damaging Het
Tbc1d2b A G 9: 90,131,915 (GRCm39) M148T probably benign Het
Tnni3k A G 3: 154,645,665 (GRCm39) S470P probably damaging Het
Tnr C T 1: 159,679,877 (GRCm39) Q284* probably null Het
Trim30a A C 7: 104,078,389 (GRCm39) V229G probably damaging Het
Trim43a G A 9: 88,464,199 (GRCm39) E37K probably benign Het
U2surp C T 9: 95,366,496 (GRCm39) V470I probably benign Het
Uck2 T C 1: 167,064,259 (GRCm39) D90G probably damaging Het
Vmn1r229 A T 17: 21,034,950 (GRCm39) E65V probably benign Het
Vmn2r26 A G 6: 124,038,129 (GRCm39) E568G probably damaging Het
Whamm A G 7: 81,235,886 (GRCm39) E363G probably damaging Het
Wrap53 A G 11: 69,453,272 (GRCm39) S390P probably damaging Het
Wrn A G 8: 33,757,848 (GRCm39) S814P probably benign Het
Zfp329 A G 7: 12,544,211 (GRCm39) C438R probably damaging Het
Zkscan8 T C 13: 21,710,930 (GRCm39) Y60C probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141,369,956 (GRCm39) splice site probably null
IGL01388:Plekhm2 APN 4 141,369,312 (GRCm39) missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141,369,737 (GRCm39) missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141,357,340 (GRCm39) missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141,356,896 (GRCm39) missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141,364,730 (GRCm39) splice site probably benign
IGL02075:Plekhm2 APN 4 141,355,617 (GRCm39) missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141,370,034 (GRCm39) missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141,369,330 (GRCm39) missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141,361,583 (GRCm39) missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141,369,835 (GRCm39) splice site probably benign
IGL02828:Plekhm2 APN 4 141,356,941 (GRCm39) missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141,361,658 (GRCm39) missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141,369,704 (GRCm39) splice site probably benign
R0008:Plekhm2 UTSW 4 141,369,704 (GRCm39) splice site probably benign
R0639:Plekhm2 UTSW 4 141,369,381 (GRCm39) missense probably damaging 1.00
R0968:Plekhm2 UTSW 4 141,357,243 (GRCm39) missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141,355,295 (GRCm39) missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141,355,165 (GRCm39) missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141,361,658 (GRCm39) missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141,369,750 (GRCm39) missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141,359,685 (GRCm39) missense probably benign
R2261:Plekhm2 UTSW 4 141,370,043 (GRCm39) missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141,369,301 (GRCm39) splice site probably benign
R3922:Plekhm2 UTSW 4 141,356,843 (GRCm39) missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141,359,168 (GRCm39) missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141,369,316 (GRCm39) missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141,355,150 (GRCm39) missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141,361,687 (GRCm39) missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141,355,411 (GRCm39) missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141,355,600 (GRCm39) missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141,367,004 (GRCm39) missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141,359,652 (GRCm39) nonsense probably null
R6367:Plekhm2 UTSW 4 141,367,016 (GRCm39) missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141,356,843 (GRCm39) missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141,359,344 (GRCm39) missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141,369,770 (GRCm39) missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141,361,687 (GRCm39) missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141,358,658 (GRCm39) missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141,355,150 (GRCm39) missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141,355,357 (GRCm39) missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141,359,432 (GRCm39) missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141,355,136 (GRCm39) missense probably benign 0.04
R8462:Plekhm2 UTSW 4 141,367,130 (GRCm39) missense probably damaging 1.00
R8504:Plekhm2 UTSW 4 141,369,764 (GRCm39) missense probably damaging 1.00
R8851:Plekhm2 UTSW 4 141,358,639 (GRCm39) missense probably benign 0.04
R8855:Plekhm2 UTSW 4 141,361,658 (GRCm39) missense probably benign 0.03
R9051:Plekhm2 UTSW 4 141,359,732 (GRCm39) missense possibly damaging 0.50
R9080:Plekhm2 UTSW 4 141,359,039 (GRCm39) missense probably damaging 1.00
R9252:Plekhm2 UTSW 4 141,356,443 (GRCm39) missense probably damaging 1.00
R9298:Plekhm2 UTSW 4 141,356,829 (GRCm39) missense probably benign
R9383:Plekhm2 UTSW 4 141,359,612 (GRCm39) missense probably damaging 1.00
R9463:Plekhm2 UTSW 4 141,357,949 (GRCm39) missense probably benign 0.10
T0722:Plekhm2 UTSW 4 141,359,292 (GRCm39) small deletion probably benign
T0975:Plekhm2 UTSW 4 141,359,292 (GRCm39) small deletion probably benign
X0024:Plekhm2 UTSW 4 141,355,352 (GRCm39) missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141,367,133 (GRCm39) missense possibly damaging 0.73
Z1177:Plekhm2 UTSW 4 141,356,396 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCAGCTCAGGTAGATGACCCAAG -3'
(R):5'- TGTCCAAAGGAGTAAGCTCACCCG -3'

Sequencing Primer
(F):5'- AAATCCGGTGGCCCCATTC -3'
(R):5'- AGTAAGCTCACCCGTGTCC -3'
Posted On 2013-07-30