Incidental Mutation 'R0682:Ssh1'
ID61002
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
MMRRC Submission 038867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0682 (G1)
Quality Score96
Status Not validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113960657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 117 (S117N)
Ref Sequence ENSEMBL: ENSMUSP00000076873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159510] [ENSMUST00000159592] [ENSMUST00000162396]
Predicted Effect probably damaging
Transcript: ENSMUST00000077689
AA Change: S117N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: S117N

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112298
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159510
Predicted Effect possibly damaging
Transcript: ENSMUST00000159592
AA Change: S160N

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: S160N

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162396
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,840 H83R probably benign Het
Abcd3 A C 3: 121,769,567 I471S possibly damaging Het
Abcg1 G A 17: 31,111,251 V509I probably benign Het
Adamts9 A T 6: 92,903,802 N497K possibly damaging Het
Agap2 A G 10: 127,083,482 S479G unknown Het
Asic2 T C 11: 80,886,680 I402V possibly damaging Het
Atp1a2 G A 1: 172,284,597 T577I probably benign Het
Atraid T A 5: 31,052,268 I92K probably damaging Het
Dpp10 C A 1: 123,905,125 A31S probably damaging Het
Erich6 A T 3: 58,636,811 F118L probably benign Het
Galnt18 T C 7: 111,520,015 Y418C probably damaging Het
Herc1 T A 9: 66,481,981 C3927S possibly damaging Het
Ifit2 G A 19: 34,573,612 R184H probably benign Het
Kif24 A T 4: 41,428,620 N113K probably benign Het
Lrp1b T A 2: 41,295,641 Y1354F probably benign Het
Muc1 T A 3: 89,231,132 I427N probably damaging Het
Muc5ac A G 7: 141,805,669 T1288A possibly damaging Het
Olfr1499 C T 19: 13,815,137 C151Y possibly damaging Het
Olfr850 C A 9: 19,477,349 M300I probably benign Het
Pex26 T A 6: 121,184,404 V47E probably damaging Het
Plekhm2 T C 4: 141,628,125 I871V probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Rnf133 A T 6: 23,649,570 I163N probably damaging Het
Rrp8 A C 7: 105,734,011 D349E probably damaging Het
Sdhd G T 9: 50,600,605 Q38K probably benign Het
Tbc1d2b A G 9: 90,249,862 M148T probably benign Het
Tnni3k A G 3: 154,940,028 S470P probably damaging Het
Tnr C T 1: 159,852,307 Q284* probably null Het
Trim30a A C 7: 104,429,182 V229G probably damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Uck2 T C 1: 167,236,690 D90G probably damaging Het
Vmn1r229 A T 17: 20,814,688 E65V probably benign Het
Vmn2r26 A G 6: 124,061,170 E568G probably damaging Het
Whamm A G 7: 81,586,138 E363G probably damaging Het
Wrap53 A G 11: 69,562,446 S390P probably damaging Het
Wrn A G 8: 33,267,820 S814P probably benign Het
Zfp329 A G 7: 12,810,284 C438R probably damaging Het
Zkscan8 T C 13: 21,526,760 Y60C probably damaging Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7647:Ssh1 UTSW 5 113942958 missense probably benign 0.00
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R7970:Ssh1 UTSW 5 113961349 critical splice donor site probably null
Z1177:Ssh1 UTSW 5 113966294 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGCCTGACCACCAAGAGAATAGC -3'
(R):5'- GTACTAAGGATGCACCTGGCAGAC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- CAGCAAAACTCCAGGTTGCC -3'
Posted On2013-07-30