Mutagenetix > Incidental Mutation

Incidental Mutation 'R7901:Rgl2'

610024

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R7901 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33935825 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 601 (L601P)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025163

SMART Domains

Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	10	115	9.6e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000025170

SMART Domains

Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

Domain	Start	End	E-Value	Type
coiled coil region	126	155	N/A	INTRINSIC
low complexity region	204	217	N/A	INTRINSIC
WD40	225	262	1.02e2	SMART
WD40	267	302	3.3e1	SMART
Blast:WD40	305	344	8e-19	BLAST
WD40	347	386	9.52e-6	SMART
Blast:WD40	392	426	3e-14	BLAST
BING4CT	439	517	8.85e-53	SMART
low complexity region	542	556	N/A	INTRINSIC
low complexity region	586	593	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047503
AA Change: L601P

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: L601P

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: L153P

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173363

SMART Domains

Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	1	89	1.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174048

SMART Domains

Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	10	115	2e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174426

SMART Domains

Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	1	89	1.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179418

SMART Domains

Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	10	115	2e-28	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,269,706	E3126G	unknown	Het
Ablim1	A	T	19: 57,131,002		probably null	Het
Adpgk	T	C	9: 59,315,017	V409A	probably benign	Het
Agfg2	A	T	5: 137,667,704	F98I	probably damaging	Het
Arhgap17	A	T	7: 123,286,568		probably benign	Het
Asb8	T	C	15: 98,142,733	Y16C	probably damaging	Het
Atp6v0a2	C	T	5: 124,641,547	T200I	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Ccnt1	A	T	15: 98,543,916	D490E	probably benign	Het
Cenpf	G	T	1: 189,657,248	D1462E	probably damaging	Het
Clcn6	C	T	4: 148,010,745	R736H	probably damaging	Het
Col4a2	A	T	8: 11,429,358	D747V	probably benign	Het
Crybg3	T	C	16: 59,557,544	T1116A	probably damaging	Het
Csf1r	T	A	18: 61,110,296	L128Q	probably damaging	Het
Ddx17	A	T	15: 79,538,588	D316E	probably damaging	Het
Ect2l	T	A	10: 18,141,964	D681V	possibly damaging	Het
Ell2	A	T	13: 75,763,986	K464*	probably null	Het
Eme1	G	T	11: 94,650,819	P59Q	probably damaging	Het
Etl4	T	C	2: 20,290,010	S2P	possibly damaging	Het
Fndc9	T	C	11: 46,237,749	Y32H	probably damaging	Het
Frem1	G	T	4: 82,959,377	T1321K	probably benign	Het
Gabrg2	A	G	11: 41,976,591	V67A	probably benign	Het
Gm4553	ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG	ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG	7: 142,164,865		probably benign	Het
Gm5145	A	C	17: 20,570,638	I93L	possibly damaging	Het
Gpld1	T	A	13: 24,962,775	V240E	probably damaging	Het
Gsc	T	A	12: 104,472,872	S82C	possibly damaging	Het
H2-T10	C	T	17: 36,120,251	E173K	probably benign	Het
Ifi213	A	T	1: 173,567,218	S584T	probably benign	Het
Klk1b1	T	C	7: 43,971,245	I253T	probably damaging	Het
Klra4	A	G	6: 130,063,150	L53P	probably damaging	Het
Lct	A	G	1: 128,288,985	Y1697H	probably benign	Het
Mrs2	T	A	13: 25,018,566	D64V	possibly damaging	Het
Muc13	A	G	16: 33,815,841	Q565R	probably damaging	Het
Nlrp6	T	C	7: 140,927,440	V873A	possibly damaging	Het
Nup155	C	T	15: 8,116,442	P159L	possibly damaging	Het
Olfr1420	A	T	19: 11,896,534	H171L	probably benign	Het
Olfr575	T	C	7: 102,955,680		probably null	Het
Olfr734	A	T	14: 50,320,116	S240T	probably damaging	Het
Phip	T	G	9: 82,890,150	M1115L	probably benign	Het
Ppip5k1	T	C	2: 121,311,909	Q1353R	probably damaging	Het
Ptprb	C	G	10: 116,369,428	P1896A	probably benign	Het
Sash1	C	T	10: 8,780,564	W221*	probably null	Het
Skint1	A	C	4: 112,019,202	T107P	probably damaging	Het
Slc45a4	G	A	15: 73,605,772		probably benign	Het
Snx13	T	A	12: 35,100,625	D309E	probably benign	Het
Spcs1	A	G	14: 31,000,671	Y64H	probably benign	Het
Tep1	A	T	14: 50,826,851	Y2434N	possibly damaging	Het
Tnpo3	T	C	6: 29,568,991	E454G	possibly damaging	Het
Tsg101	G	T	7: 46,913,435	Q24K	probably benign	Het
Ttc6	C	T	12: 57,688,567	R1132W	probably damaging	Het
Unkl	T	C	17: 25,218,653	S200P	probably damaging	Het
Uts2r	G	A	11: 121,161,408	S366N	probably benign	Het
Wbp4	A	T	14: 79,472,405	V130E	probably damaging	Het
Zfp592	T	G	7: 81,024,721	S478A	probably benign	Het
Zfp664	A	T	5: 124,885,775	K78*	probably null	Het
Zfp738	A	T	13: 67,672,991	L79*	probably null	Het
Zfyve28	C	T	5: 34,224,982	R258Q	probably damaging	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8405:Rgl2	UTSW	17	33933724	nonsense	probably null
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
R9591:Rgl2	UTSW	17	33932477	missense	possibly damaging	0.50
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCGCTGTCACTGTCTGATATC -3'
(R):5'- ATCTGGACTCGGATGATTCGG -3'

Sequencing Primer
(F):5'- CTCTGCAGAGTTCTGGGCTC -3'
(R):5'- ACTCGGATGATTCGGCAATC -3'

Posted On

2019-12-20