Incidental Mutation 'R7901:Rgl2'
ID 610024
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 045953-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7901 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34154799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 601 (L601P)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047503
AA Change: L601P

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: L601P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: L153P

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,119,434 (GRCm39) probably null Het
Adpgk T C 9: 59,222,300 (GRCm39) V409A probably benign Het
Agfg2 A T 5: 137,665,966 (GRCm39) F98I probably damaging Het
Arhgap17 A T 7: 122,885,791 (GRCm39) probably benign Het
Asb8 T C 15: 98,040,614 (GRCm39) Y16C probably damaging Het
Atp6v0a2 C T 5: 124,779,485 (GRCm39) T200I probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccnt1 A T 15: 98,441,797 (GRCm39) D490E probably benign Het
Cenpf G T 1: 189,389,445 (GRCm39) D1462E probably damaging Het
Clcn6 C T 4: 148,095,202 (GRCm39) R736H probably damaging Het
Col4a2 A T 8: 11,479,358 (GRCm39) D747V probably benign Het
Cplane1 A G 15: 8,299,190 (GRCm39) E3126G unknown Het
Crybg3 T C 16: 59,377,907 (GRCm39) T1116A probably damaging Het
Csf1r T A 18: 61,243,368 (GRCm39) L128Q probably damaging Het
Ddx17 A T 15: 79,422,789 (GRCm39) D316E probably damaging Het
Ect2l T A 10: 18,017,712 (GRCm39) D681V possibly damaging Het
Ell2 A T 13: 75,912,105 (GRCm39) K464* probably null Het
Eme1 G T 11: 94,541,645 (GRCm39) P59Q probably damaging Het
Etl4 T C 2: 20,294,821 (GRCm39) S2P possibly damaging Het
Fndc9 T C 11: 46,128,576 (GRCm39) Y32H probably damaging Het
Frem1 G T 4: 82,877,614 (GRCm39) T1321K probably benign Het
Gabrg2 A G 11: 41,867,418 (GRCm39) V67A probably benign Het
Gm4553 ACAGCAGCTGGACTGACAGCAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG ACAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAG 7: 141,718,602 (GRCm39) probably benign Het
Gm5145 A C 17: 20,790,900 (GRCm39) I93L possibly damaging Het
Gpld1 T A 13: 25,146,758 (GRCm39) V240E probably damaging Het
Gsc T A 12: 104,439,131 (GRCm39) S82C possibly damaging Het
H2-T10 C T 17: 36,431,143 (GRCm39) E173K probably benign Het
Ifi213 A T 1: 173,394,784 (GRCm39) S584T probably benign Het
Klk1b1 T C 7: 43,620,669 (GRCm39) I253T probably damaging Het
Klra4 A G 6: 130,040,113 (GRCm39) L53P probably damaging Het
Lct A G 1: 128,216,722 (GRCm39) Y1697H probably benign Het
Mrs2 T A 13: 25,202,549 (GRCm39) D64V possibly damaging Het
Muc13 A G 16: 33,636,211 (GRCm39) Q565R probably damaging Het
Nlrp6 T C 7: 140,507,353 (GRCm39) V873A possibly damaging Het
Nup155 C T 15: 8,145,926 (GRCm39) P159L possibly damaging Het
Or10v1 A T 19: 11,873,898 (GRCm39) H171L probably benign Het
Or4m1 A T 14: 50,557,573 (GRCm39) S240T probably damaging Het
Or51a6 T C 7: 102,604,887 (GRCm39) probably null Het
Phip T G 9: 82,772,203 (GRCm39) M1115L probably benign Het
Ppip5k1 T C 2: 121,142,390 (GRCm39) Q1353R probably damaging Het
Ptprb C G 10: 116,205,333 (GRCm39) P1896A probably benign Het
Sash1 C T 10: 8,656,328 (GRCm39) W221* probably null Het
Skint1 A C 4: 111,876,399 (GRCm39) T107P probably damaging Het
Slc45a4 G A 15: 73,477,621 (GRCm39) probably benign Het
Snx13 T A 12: 35,150,624 (GRCm39) D309E probably benign Het
Spcs1 A G 14: 30,722,628 (GRCm39) Y64H probably benign Het
Tep1 A T 14: 51,064,308 (GRCm39) Y2434N possibly damaging Het
Tnpo3 T C 6: 29,568,990 (GRCm39) E454G possibly damaging Het
Tsg101 G T 7: 46,563,183 (GRCm39) Q24K probably benign Het
Ttc6 C T 12: 57,735,353 (GRCm39) R1132W probably damaging Het
Unkl T C 17: 25,437,627 (GRCm39) S200P probably damaging Het
Uts2r G A 11: 121,052,234 (GRCm39) S366N probably benign Het
Wbp4 A T 14: 79,709,845 (GRCm39) V130E probably damaging Het
Zfp592 T G 7: 80,674,469 (GRCm39) S478A probably benign Het
Zfp664 A T 5: 124,962,839 (GRCm39) K78* probably null Het
Zfp738 A T 13: 67,821,110 (GRCm39) L79* probably null Het
Zfyve28 C T 5: 34,382,326 (GRCm39) R258Q probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCGCTGTCACTGTCTGATATC -3'
(R):5'- ATCTGGACTCGGATGATTCGG -3'

Sequencing Primer
(F):5'- CTCTGCAGAGTTCTGGGCTC -3'
(R):5'- ACTCGGATGATTCGGCAATC -3'
Posted On 2019-12-20