Incidental Mutation 'R0682:1700001J03Rik'
ID61003
Institutional Source Beutler Lab
Gene Symbol 1700001J03Rik
Ensembl Gene ENSMUSG00000095040
Gene NameRIKEN cDNA 1700001J03 gene
Synonyms
MMRRC Submission 038867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0682 (G1)
Quality Score180
Status Not validated
Chromosome5
Chromosomal Location146182441-146185304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146184840 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 83 (H83R)
Ref Sequence ENSEMBL: ENSMUSP00000073399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073721]
Predicted Effect probably benign
Transcript: ENSMUST00000073721
AA Change: H83R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073399
Gene: ENSMUSG00000095040
AA Change: H83R

DomainStartEndE-ValueType
Pfam:RasGEF_N 68 160 1.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199119
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A C 3: 121,769,567 I471S possibly damaging Het
Abcg1 G A 17: 31,111,251 V509I probably benign Het
Adamts9 A T 6: 92,903,802 N497K possibly damaging Het
Agap2 A G 10: 127,083,482 S479G unknown Het
Asic2 T C 11: 80,886,680 I402V possibly damaging Het
Atp1a2 G A 1: 172,284,597 T577I probably benign Het
Atraid T A 5: 31,052,268 I92K probably damaging Het
Dpp10 C A 1: 123,905,125 A31S probably damaging Het
Erich6 A T 3: 58,636,811 F118L probably benign Het
Galnt18 T C 7: 111,520,015 Y418C probably damaging Het
Herc1 T A 9: 66,481,981 C3927S possibly damaging Het
Ifit2 G A 19: 34,573,612 R184H probably benign Het
Kif24 A T 4: 41,428,620 N113K probably benign Het
Lrp1b T A 2: 41,295,641 Y1354F probably benign Het
Muc1 T A 3: 89,231,132 I427N probably damaging Het
Muc5ac A G 7: 141,805,669 T1288A possibly damaging Het
Olfr1499 C T 19: 13,815,137 C151Y possibly damaging Het
Olfr850 C A 9: 19,477,349 M300I probably benign Het
Pex26 T A 6: 121,184,404 V47E probably damaging Het
Plekhm2 T C 4: 141,628,125 I871V probably damaging Het
Rasal2 A G 1: 157,179,209 S111P probably damaging Het
Rnf133 A T 6: 23,649,570 I163N probably damaging Het
Rrp8 A C 7: 105,734,011 D349E probably damaging Het
Sdhd G T 9: 50,600,605 Q38K probably benign Het
Ssh1 C T 5: 113,960,657 S117N probably damaging Het
Tbc1d2b A G 9: 90,249,862 M148T probably benign Het
Tnni3k A G 3: 154,940,028 S470P probably damaging Het
Tnr C T 1: 159,852,307 Q284* probably null Het
Trim30a A C 7: 104,429,182 V229G probably damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Uck2 T C 1: 167,236,690 D90G probably damaging Het
Vmn1r229 A T 17: 20,814,688 E65V probably benign Het
Vmn2r26 A G 6: 124,061,170 E568G probably damaging Het
Whamm A G 7: 81,586,138 E363G probably damaging Het
Wrap53 A G 11: 69,562,446 S390P probably damaging Het
Wrn A G 8: 33,267,820 S814P probably benign Het
Zfp329 A G 7: 12,810,284 C438R probably damaging Het
Zkscan8 T C 13: 21,526,760 Y60C probably damaging Het
Other mutations in 1700001J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02022:1700001J03Rik APN 5 146183548 missense probably damaging 1.00
IGL02141:1700001J03Rik APN 5 146183465 missense probably benign 0.00
IGL02475:1700001J03Rik APN 5 146182533 utr 3 prime probably benign
R1808:1700001J03Rik UTSW 5 146184881 nonsense probably null
R2083:1700001J03Rik UTSW 5 146184871 missense possibly damaging 0.75
R2919:1700001J03Rik UTSW 5 146185191 missense probably benign 0.00
R3753:1700001J03Rik UTSW 5 146184867 missense probably damaging 1.00
R4764:1700001J03Rik UTSW 5 146185219 missense probably benign 0.00
R7242:1700001J03Rik UTSW 5 146184867 missense probably damaging 1.00
R7578:1700001J03Rik UTSW 5 146183533 missense probably damaging 1.00
R7784:1700001J03Rik UTSW 5 146182828 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTGACCATGTCACTTTGCAGGTTC -3'
(R):5'- AAGTTGTTGTTAGTCTCCGTGCTCC -3'

Sequencing Primer
(F):5'- ACTTTGCAGGTTCAGACCCAG -3'
(R):5'- ACACTGAGGAGCATTCTTGATG -3'
Posted On2013-07-30