Incidental Mutation 'R7902:Klk10'
ID610043
Institutional Source Beutler Lab
Gene Symbol Klk10
Ensembl Gene ENSMUSG00000030693
Gene Namekallikrein related-peptidase 10
SynonymsNES1, PRSSL1, 2300002A13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7902 (G1)
Quality Score216.009
Status Validated
Chromosome7
Chromosomal Location43781035-43785410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43783518 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Ref Sequence ENSEMBL: ENSMUSP00000014058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014058] [ENSMUST00000080211] [ENSMUST00000171458]
Predicted Effect probably benign
Transcript: ENSMUST00000014058
AA Change: S113T

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000014058
Gene: ENSMUSG00000030693
AA Change: S113T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 46 271 1.35e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080211
SMART Domains Protein: ENSMUSP00000079101
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Tryp_SPc 47 269 5.14e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171458
SMART Domains Protein: ENSMUSP00000132721
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 242 5.14e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamts14 T C 10: 61,205,397 S842G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc7a A G 8: 128,836,173 I1108T possibly damaging Het
Col12a1 T A 9: 79,641,581 M2161L probably benign Het
Col14a1 T C 15: 55,501,436 I1647T probably benign Het
Defb26 A T 2: 152,508,236 C41* probably null Het
Dennd3 T G 15: 73,568,115 probably benign Het
Edem1 C T 6: 108,854,377 R600W possibly damaging Het
F13a1 C A 13: 36,988,939 G156W probably damaging Het
Foxk2 A G 11: 121,299,727 T565A probably benign Het
Fsip2 A T 2: 82,977,824 I1496F possibly damaging Het
Fyb T C 15: 6,660,716 probably null Het
Gapdhs T C 7: 30,736,721 Y148C probably damaging Het
Hddc2 T A 10: 31,320,342 probably null Het
Hddc2 A T 10: 31,316,293 R64S probably damaging Het
Hist1h1d T C 13: 23,555,331 I81T probably damaging Het
Lin7a T C 10: 107,323,982 S52P possibly damaging Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Nbeal2 T C 9: 110,637,547 T763A probably benign Het
Nlrp4a T A 7: 26,450,057 I363N possibly damaging Het
Oat C T 7: 132,559,664 V381I probably benign Het
Olfr668 A G 7: 104,925,350 L138P probably damaging Het
Plpp2 A T 10: 79,527,544 I207N possibly damaging Het
Rps6ka4 T C 19: 6,831,311 E522G possibly damaging Het
Sars2 T C 7: 28,742,203 V63A probably benign Het
Sgf29 C T 7: 126,672,178 R209C probably damaging Het
Sptbn1 G A 11: 30,136,048 A1220V probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tnrc18 T C 5: 142,772,147 E1055G Het
Vmn1r158 A T 7: 22,790,008 C259S possibly damaging Het
Vmn2r120 T G 17: 57,509,244 I704L possibly damaging Het
Vwa8 A G 14: 79,092,291 S1188G probably benign Het
Zfp12 A G 5: 143,245,780 K653E probably damaging Het
Zfp933 T A 4: 147,826,601 R179S probably damaging Het
Zfp937 A T 2: 150,238,761 H237L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Klk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Klk10 APN 7 43784976 missense probably damaging 1.00
IGL01657:Klk10 APN 7 43781589 missense possibly damaging 0.49
IGL02049:Klk10 APN 7 43784458 splice site probably benign
IGL02725:Klk10 APN 7 43781620 missense probably damaging 1.00
IGL03382:Klk10 APN 7 43784459 splice site probably benign
R0433:Klk10 UTSW 7 43781565 missense possibly damaging 0.51
R1521:Klk10 UTSW 7 43782880 missense probably benign 0.00
R1580:Klk10 UTSW 7 43782862 missense probably damaging 1.00
R4825:Klk10 UTSW 7 43783598 missense probably damaging 1.00
R5969:Klk10 UTSW 7 43784985 missense probably damaging 1.00
R6437:Klk10 UTSW 7 43782817 missense probably benign 0.04
R6641:Klk10 UTSW 7 43784900 missense possibly damaging 0.94
R7589:Klk10 UTSW 7 43783627 missense probably benign 0.00
R7599:Klk10 UTSW 7 43784427 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATCTCAGGATCCCACTTCAC -3'
(R):5'- TAGGGTCTAGCTCTCACTCAG -3'

Sequencing Primer
(F):5'- AGGATCCCACTTCACTTCCTCAC -3'
(R):5'- AGCCTGAGACCTGACACTCTTG -3'
Posted On2019-12-20