Incidental Mutation 'R7902:Plpp2'
ID610052
Institutional Source Beutler Lab
Gene Symbol Plpp2
Ensembl Gene ENSMUSG00000052151
Gene Namephospholipid phosphatase 2
SynonymsLpp2, Ppap2c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7902 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79526430-79533796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79527544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 207 (I207N)
Ref Sequence ENSEMBL: ENSMUSP00000069670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063879] [ENSMUST00000165233] [ENSMUST00000166804] [ENSMUST00000218241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063879
AA Change: I207N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069670
Gene: ENSMUSG00000052151
AA Change: I207N

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
Blast:acidPPc 21 70 6e-9 BLAST
acidPPc 99 239 1.42e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165233
SMART Domains Protein: ENSMUSP00000127000
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166804
AA Change: I151N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133247
Gene: ENSMUSG00000052151
AA Change: I151N

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
acidPPc 43 183 1.42e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218241
AA Change: I89N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamts14 T C 10: 61,205,397 S842G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc7a A G 8: 128,836,173 I1108T possibly damaging Het
Col12a1 T A 9: 79,641,581 M2161L probably benign Het
Col14a1 T C 15: 55,501,436 I1647T probably benign Het
Defb26 A T 2: 152,508,236 C41* probably null Het
Dennd3 T G 15: 73,568,115 probably benign Het
Edem1 C T 6: 108,854,377 R600W possibly damaging Het
F13a1 C A 13: 36,988,939 G156W probably damaging Het
Foxk2 A G 11: 121,299,727 T565A probably benign Het
Fsip2 A T 2: 82,977,824 I1496F possibly damaging Het
Fyb T C 15: 6,660,716 probably null Het
Gapdhs T C 7: 30,736,721 Y148C probably damaging Het
Hddc2 T A 10: 31,320,342 probably null Het
Hddc2 A T 10: 31,316,293 R64S probably damaging Het
Hist1h1d T C 13: 23,555,331 I81T probably damaging Het
Klk10 T A 7: 43,783,518 S113T probably benign Het
Lin7a T C 10: 107,323,982 S52P possibly damaging Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Nbeal2 T C 9: 110,637,547 T763A probably benign Het
Nlrp4a T A 7: 26,450,057 I363N possibly damaging Het
Oat C T 7: 132,559,664 V381I probably benign Het
Olfr668 A G 7: 104,925,350 L138P probably damaging Het
Rps6ka4 T C 19: 6,831,311 E522G possibly damaging Het
Sars2 T C 7: 28,742,203 V63A probably benign Het
Sgf29 C T 7: 126,672,178 R209C probably damaging Het
Sptbn1 G A 11: 30,136,048 A1220V probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tnrc18 T C 5: 142,772,147 E1055G Het
Vmn1r158 A T 7: 22,790,008 C259S possibly damaging Het
Vmn2r120 T G 17: 57,509,244 I704L possibly damaging Het
Vwa8 A G 14: 79,092,291 S1188G probably benign Het
Zfp12 A G 5: 143,245,780 K653E probably damaging Het
Zfp933 T A 4: 147,826,601 R179S probably damaging Het
Zfp937 A T 2: 150,238,761 H237L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Plpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Plpp2 APN 10 79527493 missense probably damaging 1.00
IGL03327:Plpp2 APN 10 79530984 splice site probably null
Trust UTSW 10 79530929 missense probably damaging 1.00
R0009:Plpp2 UTSW 10 79527244 missense probably benign 0.01
R0056:Plpp2 UTSW 10 79527229 missense probably damaging 0.99
R0097:Plpp2 UTSW 10 79530537 missense possibly damaging 0.50
R0311:Plpp2 UTSW 10 79527580 missense probably damaging 0.97
R0840:Plpp2 UTSW 10 79527544 missense probably benign 0.16
R1406:Plpp2 UTSW 10 79530777 splice site probably benign
R1642:Plpp2 UTSW 10 79530684 missense probably damaging 1.00
R3436:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R3437:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R4400:Plpp2 UTSW 10 79527493 missense possibly damaging 0.88
R4521:Plpp2 UTSW 10 79530625 missense probably damaging 1.00
R4873:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R4875:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R5114:Plpp2 UTSW 10 79527139 missense probably benign 0.41
R6970:Plpp2 UTSW 10 79530546 missense possibly damaging 0.90
R7383:Plpp2 UTSW 10 79531007 missense probably null 0.99
R7953:Plpp2 UTSW 10 79530540 missense possibly damaging 0.89
R8237:Plpp2 UTSW 10 79527460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTTGGAGGCAGAACAGCAG -3'
(R):5'- TTCCCAGGGAACTTGATAGGG -3'

Sequencing Primer
(F):5'- CAGGCAGAGGTCATAGAACATTG -3'
(R):5'- TCCCTACTGCACAATGGGGTATG -3'
Posted On2019-12-20