Incidental Mutation 'R7902:Fyb'
ID610061
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene NameFYN binding protein
SynonymsB630013F22Rik, ADAP, FYB-120/130
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7902 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location6522853-6663313 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 6660716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461]
Predicted Effect probably null
Transcript: ENSMUST00000090461
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect silent
Transcript: ENSMUST00000163073
SMART Domains Protein: ENSMUSP00000123895
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:hSH3 86 170 4.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adamts14 T C 10: 61,205,397 S842G possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc7a A G 8: 128,836,173 I1108T possibly damaging Het
Col12a1 T A 9: 79,641,581 M2161L probably benign Het
Col14a1 T C 15: 55,501,436 I1647T probably benign Het
Defb26 A T 2: 152,508,236 C41* probably null Het
Dennd3 T G 15: 73,568,115 probably benign Het
Edem1 C T 6: 108,854,377 R600W possibly damaging Het
F13a1 C A 13: 36,988,939 G156W probably damaging Het
Foxk2 A G 11: 121,299,727 T565A probably benign Het
Fsip2 A T 2: 82,977,824 I1496F possibly damaging Het
Gapdhs T C 7: 30,736,721 Y148C probably damaging Het
Hddc2 T A 10: 31,320,342 probably null Het
Hddc2 A T 10: 31,316,293 R64S probably damaging Het
Hist1h1d T C 13: 23,555,331 I81T probably damaging Het
Klk10 T A 7: 43,783,518 S113T probably benign Het
Lin7a T C 10: 107,323,982 S52P possibly damaging Het
Nbeal1 A T 1: 60,291,870 I2213L probably damaging Het
Nbeal2 T C 9: 110,637,547 T763A probably benign Het
Nlrp4a T A 7: 26,450,057 I363N possibly damaging Het
Oat C T 7: 132,559,664 V381I probably benign Het
Olfr668 A G 7: 104,925,350 L138P probably damaging Het
Plpp2 A T 10: 79,527,544 I207N possibly damaging Het
Rps6ka4 T C 19: 6,831,311 E522G possibly damaging Het
Sars2 T C 7: 28,742,203 V63A probably benign Het
Sgf29 C T 7: 126,672,178 R209C probably damaging Het
Sptbn1 G A 11: 30,136,048 A1220V probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tnrc18 T C 5: 142,772,147 E1055G Het
Vmn1r158 A T 7: 22,790,008 C259S possibly damaging Het
Vmn2r120 T G 17: 57,509,244 I704L possibly damaging Het
Vwa8 A G 14: 79,092,291 S1188G probably benign Het
Zfp12 A G 5: 143,245,780 K653E probably damaging Het
Zfp933 T A 4: 147,826,601 R179S probably damaging Het
Zfp937 A T 2: 150,238,761 H237L probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0742:Fyb UTSW 15 6634816 missense probably benign 0.39
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1481:Fyb UTSW 15 6619647 missense probably benign 0.01
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R2372:Fyb UTSW 15 6651907 splice site probably benign
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5368:Fyb UTSW 15 6580678 splice site probably null
R5719:Fyb UTSW 15 6580869 nonsense probably null
R5822:Fyb UTSW 15 6663226 unclassified probably benign
R6064:Fyb UTSW 15 6638868 missense probably damaging 1.00
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
R7243:Fyb UTSW 15 6643699 missense probably benign 0.19
R7748:Fyb UTSW 15 6638826 missense probably damaging 1.00
R7750:Fyb UTSW 15 6660703 missense probably damaging 1.00
R8182:Fyb UTSW 15 6651812 missense probably benign
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACGCAGAGATGGATGTGAAACC -3'
(R):5'- AAATACTTTTCCTTGCCCTCCAAA -3'

Sequencing Primer
(F):5'- CAGAGATGGATGTGAAACCTTTGTCC -3'
(R):5'- ACAGGGTCTCATGTAGCCTAGAC -3'
Posted On2019-12-20