Incidental Mutation 'R7903:Rnf103'
ID 610079
Institutional Source Beutler Lab
Gene Symbol Rnf103
Ensembl Gene ENSMUSG00000052656
Gene Name ring finger protein 103
Synonyms Zfp103, kf-1
MMRRC Submission 045955-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R7903 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 71470878-71487865 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71486138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 256 (K256N)
Ref Sequence ENSEMBL: ENSMUSP00000066324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064637] [ENSMUST00000114178] [ENSMUST00000114179]
AlphaFold Q9R1W3
Predicted Effect probably damaging
Transcript: ENSMUST00000064637
AA Change: K256N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066324
Gene: ENSMUSG00000052656
AA Change: K256N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114178
SMART Domains Protein: ENSMUSP00000109816
Gene: ENSMUSG00000052656

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 162 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114179
AA Change: K256N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109817
Gene: ENSMUSG00000052656
AA Change: K256N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 412 431 N/A INTRINSIC
low complexity region 523 531 N/A INTRINSIC
RING 619 660 5.07e-6 SMART
low complexity region 665 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a member of the RING finger family of E3 ubiquitin-protein ligases. These proteins catalyze the transfer of the ubiquitin protein from a ubiquitin E2 enzyme to a protein substrate. Homozygous knockout mice for this gene exhibit enhanced anxiety-like behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display significantly increased anxiety-like behavior under stressful conditions as well as increased prepulse inhibition and a reduced startle amplitude with no detectable changes in exploratory locomotion or behavioral despair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,608,783 (GRCm39) probably null Het
Acsm2 A T 7: 119,195,215 (GRCm39) T596S probably benign Het
Aggf1 T C 13: 95,492,966 (GRCm39) K548E probably damaging Het
Anapc15 T G 7: 101,547,193 (GRCm39) V23G probably benign Het
Atp10a T C 7: 58,308,570 (GRCm39) L123P probably damaging Het
Brf2 G A 8: 27,616,121 (GRCm39) T88M possibly damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccdc14 A T 16: 34,525,280 (GRCm39) H191L probably damaging Het
Cdc42bpg T A 19: 6,363,499 (GRCm39) V453E possibly damaging Het
Corin T C 5: 72,458,843 (GRCm39) K1110E probably benign Het
Cubn T C 2: 13,473,680 (GRCm39) D421G probably damaging Het
D130043K22Rik T G 13: 25,059,995 (GRCm39) V622G probably damaging Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Dnah3 A G 7: 119,641,351 (GRCm39) S1190P probably damaging Het
Eif4a3l2 A G 6: 116,528,212 (GRCm39) T30A probably benign Het
Elavl1 T C 8: 4,351,756 (GRCm39) K120R probably benign Het
Epb41l3 T A 17: 69,581,332 (GRCm39) probably null Het
Fubp1 G A 3: 151,920,498 (GRCm39) W79* probably null Het
Gsto2 T A 19: 47,873,096 (GRCm39) I157N possibly damaging Het
Gucy2d A G 7: 98,108,272 (GRCm39) D735G probably damaging Het
H2-D1 A T 17: 35,482,967 (GRCm39) I166F probably damaging Het
Hars2 C A 18: 36,919,245 (GRCm39) R128S probably damaging Het
Igf1r T C 7: 67,834,500 (GRCm39) F496S probably damaging Het
Inf2 T C 12: 112,578,988 (GRCm39) V1256A unknown Het
Kif19b T C 5: 140,461,767 (GRCm39) V523A probably damaging Het
Krt34 A T 11: 99,932,321 (GRCm39) M1K probably null Het
Lamtor2 T C 3: 88,459,817 (GRCm39) N26D possibly damaging Het
Map3k10 T C 7: 27,357,382 (GRCm39) T799A probably damaging Het
Map3k8 T C 18: 4,349,162 (GRCm39) D52G probably benign Het
Mcm10 T C 2: 5,000,613 (GRCm39) T693A probably benign Het
Mgarp G T 3: 51,304,119 (GRCm39) A10E Het
Mns1 A T 9: 72,360,093 (GRCm39) E414D probably benign Het
Myo16 A G 8: 10,426,265 (GRCm39) S341G probably null Het
Nags A T 11: 102,037,503 (GRCm39) D198V possibly damaging Het
Nedd4l C T 18: 65,319,438 (GRCm39) P464S probably damaging Het
Nicol1 T A 5: 34,140,910 (GRCm39) probably null Het
Nsfl1c T C 2: 151,338,522 (GRCm39) Y42H probably damaging Het
Obscn T C 11: 58,969,942 (GRCm39) M67V probably benign Het
Or2b28 T A 13: 21,532,046 (GRCm39) I316K probably benign Het
Pcsk5 A T 19: 17,549,847 (GRCm39) L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Pfkfb4 A T 9: 108,828,019 (GRCm39) N64Y probably damaging Het
Pidd1 A G 7: 141,019,744 (GRCm39) F673L probably damaging Het
Pla2g7 A G 17: 43,911,512 (GRCm39) probably null Het
Pml T C 9: 58,156,867 (GRCm39) E36G probably benign Het
Proser1 C A 3: 53,386,503 (GRCm39) S795* probably null Het
Ptprs T A 17: 56,731,960 (GRCm39) K1016* probably null Het
Rbfox1 T A 16: 7,042,375 (GRCm39) S76R probably benign Het
Reck A T 4: 43,927,166 (GRCm39) I486F possibly damaging Het
Setd2 A T 9: 110,446,905 (GRCm39) N713I Het
Slc38a4 C T 15: 96,906,809 (GRCm39) G310S probably benign Het
Slc7a4 C T 16: 17,393,145 (GRCm39) R218H probably benign Het
Slc7a7 T C 14: 54,611,366 (GRCm39) H344R probably damaging Het
Smarcc1 G A 9: 110,033,334 (GRCm39) E810K probably benign Het
Sord T A 2: 122,093,706 (GRCm39) M275K probably benign Het
Spire2 C A 8: 124,095,489 (GRCm39) P631T probably benign Het
Sult6b1 T C 17: 79,198,279 (GRCm39) K207R probably benign Het
Syde2 T A 3: 145,704,543 (GRCm39) D498E probably damaging Het
Syne2 C T 12: 76,110,958 (GRCm39) T1024M probably damaging Het
Tdrd9 T A 12: 112,018,410 (GRCm39) D1276E possibly damaging Het
Tm7sf2 A G 19: 6,121,365 (GRCm39) F219S probably damaging Het
Tmcc2 C T 1: 132,288,199 (GRCm39) G496D probably benign Het
Tmtc4 G A 14: 123,165,060 (GRCm39) H600Y probably benign Het
Vmn1r224 A T 17: 20,640,309 (GRCm39) L295F probably benign Het
Vmn1r91 T C 7: 19,835,135 (GRCm39) I18T possibly damaging Het
Vwa7 G A 17: 35,236,763 (GRCm39) R110H probably damaging Het
Wbp2nl C T 15: 82,190,332 (GRCm39) Q87* probably null Het
Other mutations in Rnf103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rnf103 APN 6 71,486,733 (GRCm39) missense probably damaging 0.99
IGL00589:Rnf103 APN 6 71,486,067 (GRCm39) missense probably benign 0.00
IGL01601:Rnf103 APN 6 71,486,167 (GRCm39) missense probably damaging 1.00
IGL01732:Rnf103 APN 6 71,487,366 (GRCm39) missense probably damaging 0.97
IGL02130:Rnf103 APN 6 71,486,548 (GRCm39) missense probably damaging 1.00
IGL02227:Rnf103 APN 6 71,487,172 (GRCm39) missense probably benign 0.01
IGL02386:Rnf103 APN 6 71,486,202 (GRCm39) missense probably benign
IGL02532:Rnf103 APN 6 71,486,636 (GRCm39) missense probably damaging 0.96
IGL02532:Rnf103 APN 6 71,486,809 (GRCm39) missense probably benign 0.19
IGL02747:Rnf103 APN 6 71,486,161 (GRCm39) missense probably damaging 0.97
IGL02839:Rnf103 APN 6 71,486,689 (GRCm39) missense probably benign 0.41
IGL03247:Rnf103 APN 6 71,487,289 (GRCm39) missense possibly damaging 0.78
R0140:Rnf103 UTSW 6 71,486,315 (GRCm39) missense possibly damaging 0.76
R0308:Rnf103 UTSW 6 71,486,686 (GRCm39) missense probably damaging 1.00
R0764:Rnf103 UTSW 6 71,486,566 (GRCm39) missense probably damaging 0.96
R1428:Rnf103 UTSW 6 71,485,983 (GRCm39) missense probably damaging 1.00
R2362:Rnf103 UTSW 6 71,487,001 (GRCm39) missense probably benign 0.08
R3847:Rnf103 UTSW 6 71,485,859 (GRCm39) missense probably damaging 1.00
R3849:Rnf103 UTSW 6 71,485,859 (GRCm39) missense probably damaging 1.00
R3919:Rnf103 UTSW 6 71,487,331 (GRCm39) missense probably benign 0.08
R4914:Rnf103 UTSW 6 71,487,248 (GRCm39) missense possibly damaging 0.71
R5620:Rnf103 UTSW 6 71,486,992 (GRCm39) missense probably benign 0.04
R5634:Rnf103 UTSW 6 71,486,601 (GRCm39) missense probably benign 0.01
R5682:Rnf103 UTSW 6 71,485,708 (GRCm39) intron probably benign
R5791:Rnf103 UTSW 6 71,485,909 (GRCm39) missense probably damaging 0.99
R5994:Rnf103 UTSW 6 71,473,894 (GRCm39) missense probably damaging 0.99
R6347:Rnf103 UTSW 6 71,482,808 (GRCm39) missense possibly damaging 0.89
R6551:Rnf103 UTSW 6 71,487,349 (GRCm39) missense probably damaging 1.00
R7739:Rnf103 UTSW 6 71,486,463 (GRCm39) missense possibly damaging 0.77
R7819:Rnf103 UTSW 6 71,485,914 (GRCm39) missense probably benign 0.00
R8750:Rnf103 UTSW 6 71,486,602 (GRCm39) missense probably benign 0.11
R8784:Rnf103 UTSW 6 71,486,982 (GRCm39) missense probably benign 0.03
R8974:Rnf103 UTSW 6 71,486,092 (GRCm39) missense probably damaging 0.98
R9154:Rnf103 UTSW 6 71,487,099 (GRCm39) missense probably benign 0.06
R9505:Rnf103 UTSW 6 71,487,049 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTAAAGAGTACAGTGGACGC -3'
(R):5'- ACTTCAGGTTGTAATGAGCGC -3'

Sequencing Primer
(F):5'- AGTACAGTGGACGCAAGATTG -3'
(R):5'- CGCAGAAATGAATCCATGGCCTG -3'
Posted On 2019-12-20