Incidental Mutation 'R7903:Atp10a'
ID610085
Institutional Source Beutler Lab
Gene Symbol Atp10a
Ensembl Gene ENSMUSG00000025324
Gene NameATPase, class V, type 10A
SynonymsAtp10c, pfatp
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7903 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location58656166-58829420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58658822 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 123 (L123P)
Ref Sequence ENSEMBL: ENSMUSP00000129811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168747] [ENSMUST00000207668]
Predicted Effect probably damaging
Transcript: ENSMUST00000168747
AA Change: L123P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: L123P

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 55 114 5.2e-23 PFAM
Pfam:E1-E2_ATPase 120 393 6.6e-10 PFAM
low complexity region 633 643 N/A INTRINSIC
Pfam:Cation_ATPase 685 791 1.5e-7 PFAM
Pfam:HAD 697 1054 2.1e-12 PFAM
Pfam:PhoLip_ATPase_C 1071 1316 1.1e-76 PFAM
low complexity region 1458 1477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207668
AA Change: L123P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm1673 T A 5: 33,983,566 probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Tro CTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCAGTTTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCA CTGTCTGTTAGATGCCCCAATCTGTCTGTTAGATGCCTCA X: 150,654,520 probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Atp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Atp10a APN 7 58794482 missense probably benign 0.06
IGL00973:Atp10a APN 7 58807470 missense probably damaging 1.00
IGL00984:Atp10a APN 7 58658741 missense probably damaging 1.00
IGL01086:Atp10a APN 7 58824318 missense probably damaging 0.96
IGL01296:Atp10a APN 7 58813625 missense probably benign 0.02
IGL01731:Atp10a APN 7 58797562 missense probably benign 0.16
IGL02081:Atp10a APN 7 58827856 missense possibly damaging 0.62
IGL02095:Atp10a APN 7 58807393 missense probably damaging 1.00
IGL02549:Atp10a APN 7 58819733 missense probably benign 0.00
IGL02558:Atp10a APN 7 58819642 missense probably damaging 0.98
IGL02659:Atp10a APN 7 58813631 missense probably benign
IGL02986:Atp10a APN 7 58828721 missense probably benign
IGL03218:Atp10a APN 7 58788448 critical splice donor site probably null
PIT4260001:Atp10a UTSW 7 58791118 nonsense probably null
PIT4445001:Atp10a UTSW 7 58803467 missense probably damaging 0.98
PIT4810001:Atp10a UTSW 7 58813848 missense probably damaging 0.99
R0091:Atp10a UTSW 7 58774046 splice site probably benign
R0349:Atp10a UTSW 7 58803467 missense probably damaging 0.98
R0426:Atp10a UTSW 7 58784734 missense probably benign 0.00
R0609:Atp10a UTSW 7 58819740 splice site probably null
R0722:Atp10a UTSW 7 58816183 missense possibly damaging 0.75
R0741:Atp10a UTSW 7 58828589 missense possibly damaging 0.90
R1172:Atp10a UTSW 7 58803766 missense probably benign 0.05
R1342:Atp10a UTSW 7 58816146 splice site probably benign
R1648:Atp10a UTSW 7 58784827 missense probably damaging 1.00
R1715:Atp10a UTSW 7 58786505 missense probably damaging 0.98
R1737:Atp10a UTSW 7 58827238 splice site probably benign
R1799:Atp10a UTSW 7 58824434 missense probably damaging 1.00
R1909:Atp10a UTSW 7 58828712 missense probably benign 0.12
R1918:Atp10a UTSW 7 58827935 missense possibly damaging 0.82
R2031:Atp10a UTSW 7 58827930 nonsense probably null
R2080:Atp10a UTSW 7 58824327 missense probably damaging 0.97
R2424:Atp10a UTSW 7 58794555 missense probably benign 0.16
R2696:Atp10a UTSW 7 58813618 missense probably benign 0.00
R3932:Atp10a UTSW 7 58827104 missense possibly damaging 0.69
R4198:Atp10a UTSW 7 58813686 missense probably damaging 1.00
R4453:Atp10a UTSW 7 58658500 small deletion probably benign
R4632:Atp10a UTSW 7 58807438 missense possibly damaging 0.48
R4661:Atp10a UTSW 7 58658500 small deletion probably benign
R4782:Atp10a UTSW 7 58791095 missense probably benign
R4888:Atp10a UTSW 7 58785307 missense probably damaging 1.00
R4935:Atp10a UTSW 7 58813764 missense probably damaging 1.00
R5051:Atp10a UTSW 7 58740246 frame shift probably null
R5213:Atp10a UTSW 7 58773983 missense probably damaging 0.99
R5617:Atp10a UTSW 7 58803675 missense probably benign 0.06
R5834:Atp10a UTSW 7 58658618 missense probably benign 0.01
R5885:Atp10a UTSW 7 58813800 missense possibly damaging 0.92
R6013:Atp10a UTSW 7 58797790 missense probably benign 0.05
R6136:Atp10a UTSW 7 58828340 missense probably benign
R6269:Atp10a UTSW 7 58803739 missense possibly damaging 0.51
R6380:Atp10a UTSW 7 58819684 nonsense probably null
R6743:Atp10a UTSW 7 58797814 missense possibly damaging 0.89
R6875:Atp10a UTSW 7 58797352 missense probably benign 0.01
R6975:Atp10a UTSW 7 58773985 missense probably damaging 1.00
R7082:Atp10a UTSW 7 58658819 missense probably damaging 1.00
R7203:Atp10a UTSW 7 58786473 missense probably benign
R7224:Atp10a UTSW 7 58797471 missense probably benign 0.00
R7287:Atp10a UTSW 7 58827269 missense probably damaging 1.00
R7437:Atp10a UTSW 7 58658540 missense unknown
R7474:Atp10a UTSW 7 58658527 missense unknown
R7530:Atp10a UTSW 7 58773976 missense probably benign 0.02
R7561:Atp10a UTSW 7 58827133 missense probably damaging 0.98
R7743:Atp10a UTSW 7 58803709 missense probably damaging 1.00
R7767:Atp10a UTSW 7 58658849 missense probably damaging 1.00
R7861:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7944:Atp10a UTSW 7 58788359 missense probably damaging 1.00
R7986:Atp10a UTSW 7 58658822 missense probably damaging 1.00
R8015:Atp10a UTSW 7 58803497 missense probably benign 0.00
Z1176:Atp10a UTSW 7 58788447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGATCACCTAGGAGGCTGG -3'
(R):5'- TGAATGATTTTCACCTGGCCCAG -3'

Sequencing Primer
(F):5'- GAAGAGTCCGCATCCTCG -3'
(R):5'- TGGCCCAGGCTACTCCG -3'
Posted On2019-12-20