Incidental Mutation 'R7903:Pfkfb4'
ID 610098
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission 045955-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7903 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108820846-108861296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108828019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 64 (N64Y)
Ref Sequence ENSEMBL: ENSMUSP00000142378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
AlphaFold Q6DTY7
Predicted Effect probably damaging
Transcript: ENSMUST00000051873
AA Change: N48Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: N48Y

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably damaging
Transcript: ENSMUST00000198140
AA Change: N64Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: N64Y

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199591
AA Change: N64Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: N64Y

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,608,783 (GRCm39) probably null Het
Acsm2 A T 7: 119,195,215 (GRCm39) T596S probably benign Het
Aggf1 T C 13: 95,492,966 (GRCm39) K548E probably damaging Het
Anapc15 T G 7: 101,547,193 (GRCm39) V23G probably benign Het
Atp10a T C 7: 58,308,570 (GRCm39) L123P probably damaging Het
Brf2 G A 8: 27,616,121 (GRCm39) T88M possibly damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccdc14 A T 16: 34,525,280 (GRCm39) H191L probably damaging Het
Cdc42bpg T A 19: 6,363,499 (GRCm39) V453E possibly damaging Het
Corin T C 5: 72,458,843 (GRCm39) K1110E probably benign Het
Cubn T C 2: 13,473,680 (GRCm39) D421G probably damaging Het
D130043K22Rik T G 13: 25,059,995 (GRCm39) V622G probably damaging Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Dnah3 A G 7: 119,641,351 (GRCm39) S1190P probably damaging Het
Eif4a3l2 A G 6: 116,528,212 (GRCm39) T30A probably benign Het
Elavl1 T C 8: 4,351,756 (GRCm39) K120R probably benign Het
Epb41l3 T A 17: 69,581,332 (GRCm39) probably null Het
Fubp1 G A 3: 151,920,498 (GRCm39) W79* probably null Het
Gsto2 T A 19: 47,873,096 (GRCm39) I157N possibly damaging Het
Gucy2d A G 7: 98,108,272 (GRCm39) D735G probably damaging Het
H2-D1 A T 17: 35,482,967 (GRCm39) I166F probably damaging Het
Hars2 C A 18: 36,919,245 (GRCm39) R128S probably damaging Het
Igf1r T C 7: 67,834,500 (GRCm39) F496S probably damaging Het
Inf2 T C 12: 112,578,988 (GRCm39) V1256A unknown Het
Kif19b T C 5: 140,461,767 (GRCm39) V523A probably damaging Het
Krt34 A T 11: 99,932,321 (GRCm39) M1K probably null Het
Lamtor2 T C 3: 88,459,817 (GRCm39) N26D possibly damaging Het
Map3k10 T C 7: 27,357,382 (GRCm39) T799A probably damaging Het
Map3k8 T C 18: 4,349,162 (GRCm39) D52G probably benign Het
Mcm10 T C 2: 5,000,613 (GRCm39) T693A probably benign Het
Mgarp G T 3: 51,304,119 (GRCm39) A10E Het
Mns1 A T 9: 72,360,093 (GRCm39) E414D probably benign Het
Myo16 A G 8: 10,426,265 (GRCm39) S341G probably null Het
Nags A T 11: 102,037,503 (GRCm39) D198V possibly damaging Het
Nedd4l C T 18: 65,319,438 (GRCm39) P464S probably damaging Het
Nicol1 T A 5: 34,140,910 (GRCm39) probably null Het
Nsfl1c T C 2: 151,338,522 (GRCm39) Y42H probably damaging Het
Obscn T C 11: 58,969,942 (GRCm39) M67V probably benign Het
Or2b28 T A 13: 21,532,046 (GRCm39) I316K probably benign Het
Pcsk5 A T 19: 17,549,847 (GRCm39) L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Pidd1 A G 7: 141,019,744 (GRCm39) F673L probably damaging Het
Pla2g7 A G 17: 43,911,512 (GRCm39) probably null Het
Pml T C 9: 58,156,867 (GRCm39) E36G probably benign Het
Proser1 C A 3: 53,386,503 (GRCm39) S795* probably null Het
Ptprs T A 17: 56,731,960 (GRCm39) K1016* probably null Het
Rbfox1 T A 16: 7,042,375 (GRCm39) S76R probably benign Het
Reck A T 4: 43,927,166 (GRCm39) I486F possibly damaging Het
Rnf103 A T 6: 71,486,138 (GRCm39) K256N probably damaging Het
Setd2 A T 9: 110,446,905 (GRCm39) N713I Het
Slc38a4 C T 15: 96,906,809 (GRCm39) G310S probably benign Het
Slc7a4 C T 16: 17,393,145 (GRCm39) R218H probably benign Het
Slc7a7 T C 14: 54,611,366 (GRCm39) H344R probably damaging Het
Smarcc1 G A 9: 110,033,334 (GRCm39) E810K probably benign Het
Sord T A 2: 122,093,706 (GRCm39) M275K probably benign Het
Spire2 C A 8: 124,095,489 (GRCm39) P631T probably benign Het
Sult6b1 T C 17: 79,198,279 (GRCm39) K207R probably benign Het
Syde2 T A 3: 145,704,543 (GRCm39) D498E probably damaging Het
Syne2 C T 12: 76,110,958 (GRCm39) T1024M probably damaging Het
Tdrd9 T A 12: 112,018,410 (GRCm39) D1276E possibly damaging Het
Tm7sf2 A G 19: 6,121,365 (GRCm39) F219S probably damaging Het
Tmcc2 C T 1: 132,288,199 (GRCm39) G496D probably benign Het
Tmtc4 G A 14: 123,165,060 (GRCm39) H600Y probably benign Het
Vmn1r224 A T 17: 20,640,309 (GRCm39) L295F probably benign Het
Vmn1r91 T C 7: 19,835,135 (GRCm39) I18T possibly damaging Het
Vwa7 G A 17: 35,236,763 (GRCm39) R110H probably damaging Het
Wbp2nl C T 15: 82,190,332 (GRCm39) Q87* probably null Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108,828,202 (GRCm39) missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 108,858,010 (GRCm39) missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 108,859,404 (GRCm39) missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 108,836,364 (GRCm39) missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 108,836,769 (GRCm39) missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 108,839,711 (GRCm39) missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 108,856,810 (GRCm39) splice site probably benign
R0511:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 108,856,688 (GRCm39) missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 108,836,373 (GRCm39) missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108,828,237 (GRCm39) missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 108,834,677 (GRCm39) missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 108,854,110 (GRCm39) splice site probably benign
R5470:Pfkfb4 UTSW 9 108,856,661 (GRCm39) missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 108,837,489 (GRCm39) missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 108,859,462 (GRCm39) unclassified probably benign
R6139:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 108,838,630 (GRCm39) splice site probably null
R6873:Pfkfb4 UTSW 9 108,839,403 (GRCm39) splice site probably null
R6958:Pfkfb4 UTSW 9 108,839,615 (GRCm39) missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 108,836,370 (GRCm39) missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 108,856,676 (GRCm39) missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 108,840,308 (GRCm39) missense possibly damaging 0.88
R7973:Pfkfb4 UTSW 9 108,854,179 (GRCm39) missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 108,834,667 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTAGTGATCCAACAGCCTGTG -3'
(R):5'- GACCAACGTTGAATTCTGGGG -3'

Sequencing Primer
(F):5'- ATGTGCCTGAAACTAGCTGC -3'
(R):5'- GGGGAGGAGAGACAGGTC -3'
Posted On 2019-12-20