Incidental Mutation 'R7903:Setd2'
ID610100
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R7903 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110617837 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 713 (N713I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035069] [ENSMUST00000153838] [ENSMUST00000196735] [ENSMUST00000196876] [ENSMUST00000197399]
Predicted Effect probably benign
Transcript: ENSMUST00000035069
SMART Domains Protein: ENSMUSP00000035069
Gene: ENSMUSG00000032491

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Death 143 222 1.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153838
AA Change: N2491I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: N2491I

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196735
SMART Domains Protein: ENSMUSP00000143785
Gene: ENSMUSG00000032491

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Death 143 200 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably benign
Transcript: ENSMUST00000196876
SMART Domains Protein: ENSMUSP00000142925
Gene: ENSMUSG00000032491

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197399
SMART Domains Protein: ENSMUSP00000142572
Gene: ENSMUSG00000044791

DomainStartEndE-ValueType
WW 7 39 2.1e-11 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Epb41l3 T A 17: 69,274,337 probably null Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm1673 T A 5: 33,983,566 probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 splice site probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110551164 missense probably damaging 1.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1518:Setd2 UTSW 9 110602238 missense probably damaging 0.98
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2179:Setd2 UTSW 9 110594688 nonsense probably null
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4580:Setd2 UTSW 9 110574243 missense probably benign 0.06
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4651:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4652:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5123:Setd2 UTSW 9 110617527 missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110550572 missense probably damaging 0.99
R7012:Setd2 UTSW 9 110547683 missense probably damaging 0.97
R7105:Setd2 UTSW 9 110548260 missense probably damaging 1.00
R7134:Setd2 UTSW 9 110548797 missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110551462 missense
R7359:Setd2 UTSW 9 110562944 missense
R7492:Setd2 UTSW 9 110594632 missense
R7643:Setd2 UTSW 9 110567840 splice site probably null
R7869:Setd2 UTSW 9 110550014 nonsense probably null
R8004:Setd2 UTSW 9 110592545 missense
R8017:Setd2 UTSW 9 110602187 missense
R8019:Setd2 UTSW 9 110602187 missense
R8366:Setd2 UTSW 9 110548748 missense probably damaging 1.00
R8460:Setd2 UTSW 9 110594270 missense
RF009:Setd2 UTSW 9 110550711 missense probably damaging 1.00
Z1176:Setd2 UTSW 9 110532726 missense possibly damaging 0.85
Z1176:Setd2 UTSW 9 110547275 missense probably damaging 0.99
Z1176:Setd2 UTSW 9 110547579 missense probably damaging 0.97
Z1177:Setd2 UTSW 9 110547476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCTAAGAGACTTTGAAAGCTCG -3'
(R):5'- ATCAGTAGCACAGCCTTGGC -3'

Sequencing Primer
(F):5'- AGAGACTTTGAAAGCTCGGTTTCTC -3'
(R):5'- GGATTCATCCTTTCCGCTCATAC -3'
Posted On2019-12-20